Gene detail

Detailed information of ANN02819-RA in Leptoseris scabra

Genomic Location: Scaffold_3__1_contigs__length_63507380:52444481...52465754
NR annotation: XP_020612303.1, epithelial discoidin domain-containing receptor 1-like [Orbicella faveolata]
Species Leptoseris scabra · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN02819-RA

ATGGAATTTAACAATTTGTTACAAACACAAGCATTGTTACTGGATTATTGGGGCATCACCAAGGAAAGGTGTTTGTCACCCTTAGGAATGGAAGATGGTCGTATCAAGGATAGCCAGCTCAGAGCAACATCCTCTCGAAATGGTCTCGTTGCAGCTAAATATGCTAGATTAAATCAGAGTGAAGGTCAAGGAGGATGGTGTCCAGATCAGGCTCCCTTTGTCAATGAAACAGGTCCAATTTACTCTCAGTTTATACAGGTCAAGCTGGGTGCTCCTGTAAGAATCAAGGCCATCACCTTACAGGGCCTGGCTGGTGGAATAGAAAAAGTGGAGCATTATTGGATTAATTACCGTTTCTCAGGTACTTCGCATTGGATTTATGATGAAAGTGGCACTGTTAAGGGAAATGTGGACAGTAAGTTACAGACAAGCATGCTGAGACCACCCGTTGTTGCAGATGACATCAAAATTATTCCTGAAATTTATCCTCGCATACAAGTGTGCATGAGGTTTGAGCTTCTTGGCTGTTCATTTAAGAATGGGCTTGTGTCGTACACCATGCCTCAAGGAAATGAAAGAGAAGGAAGATACAACTTTACAGATTCAATTTATGATGGCTCAACCAAGGACAACGTTCTATCATCTGGTCTTGGATTTCTCAGTGATGGAAGGCTAGCCCCTGCTGATTATGTTGACAACAATGGATTAGGTTGGATTGGCTGGAATGTTAAGAGAACGCCAGCCCCTTACATCAGCTTCGAATTCTTGGACACTAGAATCTTCCATTCTGTGACTATTCATAGCAACATCAGGGATCAAGCAATGATTAAATTGTTCTCTGAAGTTAAAGCAAGTTTCAGTGTGGATGGGACTTCCTTTAACACTTTGTGGACACACAAATCAAAACATGTTACCAGTGGATCAAGTTGGATCAATTATAATGCTACAGTTGACTTGTGCAAGAACACTGGAAAATCGGTGATGTTAAACTTCACCTATACAGGGGAATGGATTTTAATCAGTGAGGTTACTTTTAGATCAGAACCCCTTGGTTCCAAGTCACCTCCTGAGGTTTACTGTGATTCCACGGTGATCCCACCACAGTCTACAGTGCCGCCATCAGATATAGGAACTTTATTAACTACCAGCAGCACAACAAAGGGAAGTCAGGCTGTCGATCACACTGATGGCAGTACGGATAGCGGTTCCCTGGACGGTGGTGTGATAGCTGGTATCGTTTGTGCTGTGTTAGCTGTGCTGGTGATTATTGTTCTATTTGTCTGCTGGTGGCGTTATCCTCACTGGTTCTTTCAACGCGAGAAACCTTTCAACTATTTTATCAAAGTTGAAATGCAGCCTTCTAATAATTATGGGGCTCAGCCTCGTCGCGTGTCTCGGTTGGACAGTACTGCAAGTGAATGTGATGAGAAAAGAAGTAGCTTCAAGAGAAATGGTCAGAGTGGGGGAGGGGGTGGAGGAGCTGAAGTGACTGCCTGCCCTATATATGCCAGCATAGGCGAAAATCTGGATAAGGAAGCTGCTACAAACGGCTACGTCAACAACACCCACAAGTTTCACAGAGTTGGCTCTGATGTCAAACCTCTGAAAAAAGTGAAGCCTCCTGTTCCACCGCCCCTCCAGCCGGTGCATTCTGTTCCAGAAGTCATATATGCAGAGCCAGACACTCCTTTGTTACTGTCGTCCTCTCCATCTCCAGGGCCTTCTCCAAAACCTCCCATCCCACCGCGGAATTCACAAATGGACTTCTCTGAAGATTTTCCAGATAATGATTATGCGGAGCCCGACACCCCCTTGGAAAAAACCCCCATGTTAATAGTTTCCCCTGGCAAGCCTAGAGTTGTCAGTGGGTATGCTGATCCGATCGATGCCTTATCGCCAACATTGGACAACACATTCCACAATCCTATATATGAGCAGGTGTACTCGGAACCTTATCAGGGTGTCTCCGGCACCAGTTTATATTGCAATCCAGATGATGAACTGAACATGAGACCCAGACAAGACAGTTTTAAAGACTTCCCACGGAACAAGCTGCATTTCAGAGAGAAGATCGGAGATGGTCAGTTCGGAGAGGTGCATATCGGCGAGGCTGAAGGTTTGGATAAACTTTTAGGTGGTGAATTCAAGAACATCCAACGAATGACCGTGGCTATTAAAACACTGAAGCTTGATGTTGATAAGAACATCAAGAATGAGTTCTTCAAAGAGGTGAAAGCCATGGCAAGCCTCAGGCACATGAATGTGATTCGTTTGTTGGGTGTGTGTCGTGATGATCCCATGTGCATGATTGTAGAGTACATGGCCAATGGCGATCTCAACCAATTTCTCAAAGAGAGAGAACTGGAACCCAACTTGTCTGTAGACCAAAGCATGGGAGGGGAGAGCGAGGGGCAATATGTCTCTCTCCACGCCCTCTTCTACATGGCAAAGCAAGTGGCTGCTGGCATGAAGTACATTTCATCTTTGAACTATGTCCACCGTGATCTGGCCACGCGGAACTGTCTGGTCGGCCACGCTTACACAGTAAAGATTGCAGATTTTGGAATGTCAAGGAATTTGTACTGTAAACATTACTATCGCATCGAGGGGCGAGTTATTTTACCAATACGGTGGATGGCACCGGAGTGCATTCTTCAAGGTCGCTTTACCACCGTTAGTGATGTATGGGCGTATGGTGTGACCCTGTGGGAGATCCTCACTCTGGCTCGAGAGTACCCCTACTCGGATCTCAGTGACGAGGAGGTGATCAGTAACATACAGGCCATGTTTCACCGGCCGGACACACCGTTCACTGCCCTGCGTCAGCCTGACATATGCCCAGATGATTTGTACGAACTCATGTTACGCTGCTGGAGAAAAGAACTAGAGGAGAGGCCAACGTTTGGAGAGCTACACAGTAATTTAGCGGAACGTGTGCGATTCAGCGAGGCTAATGTTTAG

Transcript

ANN02819-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q63474	Epithelial discoidin domain-containing receptor 1 OS=Rattus norvegicus OX=10116 GN=Ddr1 PE=2 SV=1
Q03146	Epithelial discoidin domain-containing receptor 1 OS=Mus musculus OX=10090 GN=Ddr1 PE=2 SV=2
Q08345	Epithelial discoidin domain-containing receptor 1 OS=Homo sapiens OX=9606 GN=DDR1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001980 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF21114 all species →	DDR1-2_DS-like	Discoidin domain-containing receptor 1/2, DS-like domain	Domain	Interproscan
PF00754 all species →	F5_F8_type_C	F5/8 type C domain	Domain	Interproscan
PF07714 all species →	PK_Tyr_Ser-Thr	Protein tyrosine and serine/threonine kinase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR050122 all species →	Family	Receptor Tyrosine Kinase	Interproscan
IPR002011 all species →	Conserved_site	Tyrosine-protein kinase, receptor class II, conserved site	Interproscan
IPR000421 all species →	Domain	Coagulation factor 5/8 C-terminal domain	Interproscan
IPR048525 all species →	Domain	Discoidin domain-containing receptor 1/2, DS-like domain	Interproscan
IPR008979 all species →	Homologous_superfamily	Galactose-binding-like domain superfamily	Interproscan
IPR011009 all species →	Homologous_superfamily	Protein kinase-like domain superfamily	Interproscan
IPR001245 all species →	Domain	Serine-threonine/tyrosine-protein kinase, catalytic domain	Interproscan
IPR008266 all species →	Active_site	Tyrosine-protein kinase, active site	Interproscan
IPR000719 all species →	Domain	Protein kinase domain	Interproscan
IPR020635 all species →	Domain	Tyrosine-protein kinase, catalytic domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24416 all species →	TYROSINE-PROTEIN KINASE RECEPTOR	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004714 all species →	Molecular Function	transmembrane receptor protein tyrosine kinase activity	Interproscan
GO:0005518 all species →	Molecular Function	collagen binding	Interproscan
GO:0005887 all species →	Cellular Component	plasma membrane	Interproscan
GO:0007169 all species →	Biological Process	cell surface receptor protein tyrosine kinase signaling pathway	Interproscan
GO:0007275 all species →	Biological Process	multicellular organism development	Interproscan
GO:0010976 all species →	Biological Process	positive regulation of neuron projection development	Interproscan
GO:0014068 all species →	Biological Process	obsolete positive regulation of phosphatidylinositol 3-kinase signaling	Interproscan
GO:0033674 all species →	Biological Process	positive regulation of kinase activity	Interproscan
GO:0038062 all species →	Molecular Function	protein tyrosine kinase collagen receptor activity	Interproscan
GO:0043235 all species →	Cellular Component	receptor complex	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0006468 all species →	Biological Process	protein phosphorylation	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0004672 all species →	Molecular Function	protein kinase activity	Interproscan
GO:0004713 all species →	Molecular Function	protein tyrosine kinase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K05125	DDR2, TKT, CD167b; discoidin domain receptor family member 2	EC:2.7.10.1	CD molecules	ko04090	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Leptoseris scabra tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Leptoseris scabra, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →