Gene detail

Detailed information of ANN03529-RA in Leptoseris scabra

Genomic Location: Scaffold_5__1_contigs__length_58733080:31184...50158
NR annotation: CAH3181984.1, unnamed protein product [Porites lobata]
Species Leptoseris scabra · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN03529-RA

ATGAACAACATTGTCCGCATCCAGCCCATGCAATATATTCACCTCTTAGACCTGAACACAAATGTGACTGTTCTGGAGGTTGGACCAAAAAGTTTAATTCTTCAAGATAACCATCAGTTAGTGGAAGGGCCATTACCATATGTTGTCATCCCACCAGGTCATTACTGTGTCATAGAGAATCCTGTCAAAGAACCATGTGAACCAGGCAAGCAGTGTGATTTACACCATGGTTACAGAGACATGAGGTTCTTTAAAGAGCCTTTTCCTCTCTACCCTGGTGAAACCATTGAAGGGGCAAAAAATTTGAAAGGATACAAATCTGGAATCAGGAAACTTCCAGTTGTTGGACCAAATGAAGGCCTTCAATTGGCAGCTGTCATAGATCACATGGATGGTGATGAAGAGCGCAAAACTGGAGATTTGTGGCAGCTTGAAGGGCCGTTAACCTACCAGCCAACTCCTTACGCTGAAATAGTGAAAAGGGTAAAACCTTGCATTATTAAACACGGACAAGCATTACGGCTAAGAGCAAAGCAGGGCCTTGTTGACAAGAGGGGAAAACTCATCTCTGAAAATTTTAATCACCTTTTCAGGAAACGTGTGACGTCTGAAGAGTGGTTGATTAGAGAGCTTGGAGCATATCTACCTGGCGTCTATGAACAGGTTGTTGGTATTGAGCATGCCCACACACTCACTGAGGACAAGGCTCTGCACATGAGAGCAAAGCAGACTTGCGTTGATGCACTCGGGAAAAAGAGAAATGTAGGAGACGAGTGGCTCGTCACTTCAGAAGACACTGAGATGTACATTCCAGAGGTGTCTGAGGAAGTTGTAGCAGAGGTGTCTCAAACAGTGCTGTCTCGTCAAGAGTATTGTATTGTTACTGAACCCATGGACAGCAAGGGGCGTAATCAGCTGGGCAAGAGAGAGCTGCGTAAAGGAGTTATAAGCTTTTTCCTGCATCCGGGTGAGGATTTGGATGGTGGAATATTGAAGTCTTATGTTCTGGAAGCTGATGAAGCTCTAGTGTTGTCTGCTGTTGATCATTTTGATGATGACTCTGTGAAAAAGAAGTGTCATCGCTCTCCCGGAGATCGCTGGATGATCTTTGGTCCAACTGAATATATTCCACCAATAGAGGTCACTGTTAAATCAAGAAGGAAAGCCATACCTCTTTGTGAAAACGAAGGAATTTATATCAGGGATACCCAGAGCGGTGCAGTCCGAGCGGTAATGGGCCCCCAGTCATATTTACTGAAGGCGTATGAGGAACCGTGGGAGAAGGAACTTAGTGACGATGTGGAAAATATTCTCAAGAGTGGCGGAGGTATCGGCAGTGGTGACATTCGGAAAATGGCGTACTTTGAATCGTCTATTGATCCTACGATCGCACGTGCTGAGGGCCGTGACAAGACACGAGTGATTGTGTACCGTTGTCCAGGAAACACTGCAGTGCAGGTTTATGATTACTTACGGAAGACAGCGAGGGTGATCTTTGGACCAGACCTTGTTGTACTTGGACCACATGAGAACTTTAACGTGCTTAGCTTGAGCGCTGGGAAACCGAAAAAGCCTAATGCTTTGAAGACAATATGTCTGATGCTTGGGCCAGATTTTATCACCGATGTGATTGAGGTTGAAACGTCCGATCATGCTCGCTTGAAGATCAAGATAGCAATGAACAACTTCTTTGAGGTTGAATGGGGGAATCACGAATCAGAACAAGCCATCTTTTCTGTGCCGGATTATATTGGAAATGCGTGCAAGAGCGTTGCCAGCAGGATCCGTGGCAAGGTAGCACAAGTTTCTTTTGATGAGTTTCACCGTTATTCCACATCTGTGATAAAGAAAGCTGTGTTTGGCGTGGATAAAGACGGAAAAATCAAACAAAGACTGCGATTTGATGCGAACCAACTTGTGGTAACTAACATCGACATCCAGAGTATTGAGCCGGTGGATCTACATATGAGCGAAAGCCTCAGCAAATCGGTGCAGATGGCCATTGAAATTTCAACCAAATCTATTGAGCGAGCAGCAGAGCACGAAGCAAAGAGAACGGAACAAATGGCCAAAGGATCGCTAGAAAGACAAAAACTCACCAACGAAAAGGAAGCTGAAAATGCTCGAGTGAGTTTATTTGAACTGCGAGCGGTCACTGCTGCCGTGGAATCATCTGGACAGAAAAAAGCTGAAGCGCAGGCCCAGGCTGAACGGTTACTAATCGAAGGTGAAAGCGCAATTGAAGTTGCCAAACTGAACGCAGAAGCTGCAGAAGTCGAGTTGAACGCGGAGTTACACTCTCAAGAAATGGAACAACAAGGTGAACTTGAACATCTGAAACAACTAAATCAGCTGGAAATACAAAAGGCCAAGGAATTAGCCGATATCGAGGCTAACAAACTCGCTGCAATGATGAAAACCATAGGCTCGAAGACGATCAACAAAATTGCTCGATCTGGTCCTGATTCGCAGGCTGGCCTTCTCAAGGGACTGGGGATACAGAATGTGTTAATCACCGATGGGTCCACACCGCTGAACTTGTACCAGTCCTCTGGCGGATTTGTTCAGCCCGGCATGATGAGCTGA

Transcript

ANN03529-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9DGM7	Major vault protein (Fragment) OS=Ictalurus punctatus OX=7998 GN=mvp PE=2 SV=2
P34118	Major vault protein alpha OS=Dictyostelium discoideum OX=44689 GN=mvpA PE=1 SV=1
Q6P3L0	Major vault protein OS=Danio rerio OX=7955 GN=mvp PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001599 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF17796 all species →	Vault_4	Major Vault Protein repeat domain	Domain	Interproscan
PF11978 all species →	MVP_shoulder	Shoulder domain	Domain	Interproscan
PF01505 all species →	Vault	Major Vault Protein repeat domain	Domain	Interproscan
PF17795 all species →	Vault_3	Major Vault Protein Repeat domain	Domain	Interproscan
PF17794 all species →	Vault_2	Major Vault Protein repeat domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002499 all species →	Repeat	Major vault protein, N-terminal	Interproscan
IPR041136 all species →	Domain	Major vault protein repeat domain 4	Interproscan
IPR021870 all species →	Domain	Major vault protein, shoulder domain	Interproscan
IPR043023 all species →	Homologous_superfamily	Major vault protein repeat domain superfamily	Interproscan
IPR043179 all species →	Homologous_superfamily	Major vault protein repeat domain 2 superfamily	Interproscan
IPR039059 all species →	Family	Major vault protein	Interproscan
IPR036013 all species →	Homologous_superfamily	Band 7/SPFH domain superfamily	Interproscan
IPR041139 all species →	Domain	Major vault protein repeat domain	Interproscan
IPR040989 all species →	Domain	Major vault protein repeat domain 3	Interproscan
IPR041134 all species →	Domain	Major vault protein repeat domain 2	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR14165 all species →	MAJOR VAULT PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K17266	MVP; major vault protein	-	Exosome	ko04147	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Leptoseris scabra tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Leptoseris scabra, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →