Gene detail

Detailed information of ANN04439-RA in Montipora grisea

Genomic Location: Scaffold_4__1_contigs__length_64434164:4008092...4029975
NR annotation: XP_029206738.2, uncharacterized protein LOC114970460 [Acropora millepora]
Species Montipora grisea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN04439-RA

ATGGCAAACTACGATGACAATCCATTCGCTGGGGATTCGGAGAATCCATTTGCCGATCCCTCTGTGGCTTCACATACCAGCAATGCAGCTCGTGGGCTTGAAGACTTTAATCCTTTTGGAGACCAAAACACTTCTCAATCCAATAGCAGTGCTCCCAAGCTCAAGACAACGGCAGCTGTGCCACCCCCTCCGCCCTCACAACCAGCACCACCTCCCCCATCACAACCTGCTGTGCTTCAGACCAAAGAGGAACCACCTCCTTATATGGTTGAGGAAGAGCAAGATAACTTAAGAAGACGGCAGGAGGATTTAGAACGCAAAGCTGCAGAATTACAGAGAAAAGAGCAAGAATTGCAACGGATGCAGTTTGGAGGTTATAGAGAAAACAATTTTCCACCATTGTGTGCAAGGTGTCCTTGCAAACCATGTTTTTTTCATGACATCAGTATCGACATTCCCATCGATTATCAAAAGACGTGCAAAGCCCTTTTCTTCAGGTGGCAAGCGTATTTTTTCACATTGTTCTATAACTTCCTTGCGGCCTTTGCATTGCTTGTCACTGATGCCGAGCCAATTCATGCTGGCGAAACATTTGGACTCTCCTTGTTGTACTTATTTGCAAATGTGCCTTTATCATTTGTTGCGTACTCTTTTGTTCTGTTCTTTAACTTCCTCGCTGCAATGGCCCTCCTAATCAAAGGATCGGGTAATGCTAATTTGCAAGAGGGCACCACGTTTGGCCTGTCTGGCTTGTACCTAGTTGCAAATACCCCCCTGTCATTTATTGGCTGGTATCGACCATGCTACAATGCTCTCAAGAACGACAGCTCCTTTAGCTACGTGATTTTCTTCCTGATCTTCTTCCTTCACATAGGACTCCAAATATTTTACTGTCTCGGTATCTCTGATGACTTCAACAAAGAAAACATTTCAATCAATACAACGAAAAAGCCACGAAGTCAACGTCGCACAACCGGACTTCAATGCAGTTTTTACGAGTGCCAAAACAGTTATTATTCTGCTGACGGCAAGAGAAGCATGTTTCATTTCTTCAGTGTTCCCCTGAAAAACCCAGAGAAAACGATATGGTGCAATAAAATGGGAAAAGTCGAAGGAAAGGACGGCTTTCGTGTTACTAAAAACACGAAAGTATGTCACCTACATTTTAATAAGGAGGATGTCTTGAAGGTCCCCGGGGGATCCCGCTGGAAGTTAAGGGAGGATGCAAAGCCGATAAAACACAACTTTTCGACGCCTCGAATGAAGCGAAAACCACCGCTGTTTAGATGCGAGAAGCTTAAGCCAAAAAGGTTAAGGTTTGGCGAGAAGAACGAGTGTTCTCCGGTCCGCTTACACCAACCCAAATCACTTTTTGAGACTTCTCTGTTGGTAGTGAAAGCTTCCACATCTGCAACTAGGCGCGAAAACATACGGCTGAAAACTGAACTCGAAAAAACTAAAGAAGAATTAGAAGCTACAAAGGATAAAATGAGAAAGACCAAATTTAGTGTTGATACCATTAGGAATAATGATAAACTGTGTAAACATTACACTGGGTTTCCAAACTTCGACAGATTTAGAATTTGTTATGAGTTTTTGAGAGCAGGGGAAAATGGGGAAAATGTTATCACGAAAGATGCAAGTGGTGCGAAGACACGCCCAGGGGCAAGAGCTCTGTGTTGTGAGGATCAATTTTTTTTGGTGCTACTGAAGTTAAGAACGGGTTACTCAAACATTCACTGTGGCTGGCTATTTAATTGTGATGAGAGCACAGTATCTAGGCTTGTCTGCAGTTGGATTAATTTTATGTTCCTTCAGTTTGGTTCTCTACCAATTTGGCCTTCAAGGGAAGAAATTGATCAGTCTATGCCAGAAAGTTTTCAACAGTCCTTTCCAAAAACAAGGGCAATAATTGATTGCACTGAGGTGTTTGTCGAGGCACCAGAGTCCCTACATATGCGATCCTCTTTGTACTCAGACTACAAGCATCACAACACCTACAAAGCACTGGTTGCTATCACACCTGCTGGAAGTCTGTCCTTTGTGTCTGAATTATTTCCTGGAAGTGTCTCTGATAAAGAGATTGTCAGCAGGTGTGGCATCCTAAATTCCAAGTTTTGGGACAAGGATGACGAGGTAATGGCAGACAAAGGATTTGCTATGAGAGATTTGTTAGATCCTCTTGGGGTGAAGCTGAATATTCCTTTTTTTTTTGGAGGATCAGATGCAATTTTCACCAATGCAATGGTTTTATCAATGCAACTCAAGCAATTCACCAAAGTCTACCTGTAG

Transcript

ANN04439-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O77735	Secretory carrier-associated membrane protein 1 OS=Sus scrofa OX=9823 GN=SCAMP1 PE=2 SV=1
Q8K021	Secretory carrier-associated membrane protein 1 OS=Mus musculus OX=10090 GN=Scamp1 PE=1 SV=1
P56603	Secretory carrier-associated membrane protein 1 OS=Rattus norvegicus OX=10116 GN=Scamp1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002763 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13613 all species →	HTH_Tnp_4	Helix-turn-helix of DDE superfamily endonuclease	Domain	Interproscan
PF04144 all species →	SCAMP	SCAMP family	Family	Interproscan
PF05485 all species →	THAP	THAP domain	Domain	Interproscan
PF13359 all species →	DDE_Tnp_4	DDE superfamily endonuclease	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR006612 all species →	Domain	THAP-type zinc finger	Interproscan
IPR027805 all species →	Domain	Transposase, Helix-turn-helix domain	Interproscan
IPR007273 all species →	Family	SCAMP	Interproscan
IPR038441 all species →	Homologous_superfamily	THAP-type zinc finger superfamily	Interproscan
IPR027806 all species →	Domain	Harbinger transposase-derived nuclease domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23080 all species →	THAP DOMAIN PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0015031 all species →	Biological Process	protein transport	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for ANN04439-RA.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora grisea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora grisea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →