Gene detail

Detailed information of ANN07537-RA in Montipora grisea

Genomic Location: Scaffold_9__1_contigs__length_82041408:52360670...52363114
NR annotation: XP_015772742.1, PREDICTED: putative protein arginine N-methyltransferase 9 [Acropora digitifera]
Species Montipora grisea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN07537-RA

ATGAGTACAAACTCGCGATATTCACAGTATTTCAAAGCTGCCAAGAACTCCCTCATACGAGAACAATACGGAGATGCATTGGCGCACATGGTGTTTATTGCAAATGTCGAGCCTTCCATGAGAAAAGTCTTGGAAGAAGACTTCATCGTCGCTTTACGCCACTGGGTCGAGATTCTTGAACGCCATGGAGAGCTAGAGAAACTCATGGTTTGCCTTCAAGAAGCTCTGAAGCTGTATCCTCAAAGTGAAAACATTCTAATCAACGCAGGAGCAAGTTTACTGAAGCTAGGATTCAGTGATGAAGCAGCCTCGTGTTTTAGACGCGCACTGCAAGTCAATCCTATGAATTTAAGAGCAAAGGAAAATCTTGAAAACCTCAAAAATTTATTGGTAGAGAGATGGCATTTCAGGATGCTTAATGATAAGCAACGAAACACTGCTTACAAACAAGCCGTTTGTAGAGCCATATCGCAAGGGCATAACACTGTGTTAGATATCGGAAGTGGAACTGGTATTTTAAGCATGTTTGCAGTCCAAGGAGGTGCAGAAGAGGTCTATGCATGTGAAATGTCAAAGACCATGTATGAAATGGGTCATGATGTTTTAAAAGCTAATAAAATGGAAACACAAGTTCACACCATACATAAGAAGTCAAGTGATATGAAAGTGGGTGACGATATCCCTAAAAGAGTCTCCCTTGTCGTCACTGAGACTTTAGATTGTGGACTCCTTGGTGAGGGAATCCTAACAACTATTGAACATGCTTGGACACACTTACTTTTGCCTTCCAAGGGATCTGCATTGCAACAACCTGACTTTAATCCTGTTTCAAAAGTAATCCCAGGTGGAGCTGTCATGTTTGCTGTGGTAATCATGTGTGATGATATCAAGAATCAGTCAAGATGCAAACCATTCATGTGTGGATTGAGGATGTTTCCCGAGTGCAGCATAGGTGGTGAAGTTATGGAACAAAAAACAAAAGTGACATCATCTATAAATGTATGGGATCAATTGGAGCCATACAACACTGAATGTTTGAATAATCTCCGAGGTGGATTCACACTCCTTTCTTCTCCATTTAAAGTTGCAGAATTCAATTTTAATGATCCAAGCAGCTTATGCAGGGAGAGAGATTTGCATTTGGAGATCCAAGCAGCAAATGATGGCAGAGTTGATGCAATTGCAGCTTGGTTTGATCTGCTTTTGGATGATGAAACCACTCTCTCTACTGCACCTGATGACAATTCTCTTTGTTGGGAACAAGCAATTTTCCCCTTTCATTTGGACCGGAAAGATCATGAAGTTTCAAAGGGAGATTTGCTGTCTGTTCATGGCCATATATCTCAAGACTGCATGAGATTGACATTTGGTGGCATTTTGAGTGAAGGTAATGTTGCAAAAGAGAAAGTTCATCTAAAAGATGCTGATTCTATGGTTGAGAAAAGCACTTCTCTTGGTGATGTTACCATTATTCCATCTTCATACATGAGACGGTTGAATGATGAGGTCTTCAATGAGCTTTATGAAGATGTTATTTGCAGTGCTATCAAAGGCCTGAAACCTGAATTTTATAGTGTTGGTCATTTGAATAATGGTCTAAAGTCAGTGGAGGGCACTAATGAGTGCAATGTTCTTGACATCACATGTGGCCCTTCTCTGTTTTCTCTGTTTGCATCAAGAGGTCAGGCAGATTGCATCCTGATGTGTACTCCACATAGCGCAACATGGACTGACCACATTTTGACTGGAAATGGCCTACCCTCTGTCATTGAATATGGTCCTAAGAGACTGGAGGAAATTGCCAAAGAGGGAACGGACAGAAGATGGAATGTTTTGATCAGTGACATTGTTGAACCATCGGGAACCCTTCGCCAGCAAGTCATTGAAGACGTTGTATTTGCACGGGGTTGCTTGCTGACGCCAGGCAAGTTTCAAATCCTTCCCATGGGATTCACTCTCTACTGCATGTGTATTGAATCACCTTTCTTGTTTGCAAATTGCTGTATTATTGATGAAGACAATACTTTAGGACTTGACATTGGGCGATTTGTGAACGAGTTTCAAGTTTCCACTCAAGTTGATCTTGACCTAACGAACCTTCCTTTCACAGCTCTCACTGAAAACATAACCCTTTTCAGCCTGAACTTTATGGAAGACTTTGCAGACAATCACAAAGTTCTTTCAATGCTAGAAACTCGCTGTGAGCAGAAGGTCAAAGTTGTTAAATCAGGGAAAATTCATGCTATTCCTTATTGGTTTATGATGCATGTGGACACCAAACACTCACTGTCTACATACAGTGGTGCTTACACAGAATCACACTGGAGGCAAGCTGCACTTATTTTAAAAGATGAAATGTGTGTTGAAGCTGGGCAAGAGCTGCTCATTTCAGCATCATGTGTAAACAGCAATATCTTCATTAATGTCAGTGTCGTTAAATGCTAA

Transcript

ANN07537-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6P2P2	Protein arginine N-methyltransferase 9 OS=Homo sapiens OX=9606 GN=PRMT9 PE=1 SV=1
Q3U3W5	Protein arginine N-methyltransferase 9 OS=Mus musculus OX=10090 GN=Prmt9 PE=2 SV=2
A0JMU5	Protein arginine N-methyltransferase 9 OS=Xenopus laevis OX=8355 GN=prmt9 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006326 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF06325 all species →	PrmA	Ribosomal protein L11 methyltransferase (PrmA)	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR019734 all species →	Repeat	Tetratricopeptide repeat	Interproscan
IPR011990 all species →	Homologous_superfamily	Tetratricopeptide-like helical domain superfamily	Interproscan
IPR029063 all species →	Homologous_superfamily	S-adenosyl-L-methionine-dependent methyltransferase superfamily	Interproscan
IPR025799 all species →	Family	Protein arginine N-methyltransferase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11006 all species →	PROTEIN ARGININE N-METHYLTRANSFERASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0016274 all species →	Molecular Function	protein-arginine N-methyltransferase activity	Interproscan
GO:0018216 all species →	Biological Process	peptidyl-arginine methylation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K19737	PRMT9; type II protein arginine methyltransferase	EC:2.1.1.320	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora grisea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora grisea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →