Gene detail

Detailed information of ANN13612-RA in Montipora grisea

Genomic Location: Scaffold_1__1_contigs__length_50156999:5227259...5258438
NR annotation: XP_044183095.1, acylamino-acid-releasing enzyme-like [Acropora millepora]
Species Montipora grisea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN13612-RA

ATGAAGTGGCTACGCCCGATGGATTTTGGCGCTGGCCGGAAAGCAAAGACCTTGATCCTGAAACGGACTTCCTTCAAAATGGAAGAAGAATTTGGATCTGAGGTATTTGTGGATAAAGCAGTGGCAGTCTACCGAGAATTTGCTAAGACCGGCTCTGTAGTCAATGCAAAGGTTTCTTTCCTTAGTCAAGATAATGATAAGTCAGGATCAGCAGAGCTGAGCATTGTTTCCAGTTGGTCTCAGCGGGATCTGGAGAGAAATGAAAATCGTACTTTTCAAAGAAGCCATGTTACAAGTTACGATGCCACCACAAAGTCGTTTACTAATATTAGAGAGCTGTCATTTCCTGTGGAAGTTCAAAACTTACAATTATGCACTGTGTCAGCAACTGGGAAAATCCAAGCCATAGTACGAAATGTTCCAGGAAGCAAAGGTCAAGAAGACAAACAATTTTTAGAGATTTGGTCCACAAGTCACTTGTTAAAAAGCATTGATGTACAAGTTTGTGAAAAGCATGGAAAGATCTATGAAGATTTTCAGTTTGGTTGTCTGGCCTGGTCATCATCTGAACAGTTCTTATTGTATGTGGCAGAGAAGAAATTGCCTAAAGCTGTTTCTTACTTTGAACGGCAAAAAACAGATGCTTCAGCTGACAAACCAGCTCCACAAAAGGGAGCACAATTCGATTTTAAGGATGACTGGGGTGAGCAGTTGGTATCCAAGAGTTGTCCCGTTCTTGTCATATACGATGTGATAACTGACGAGATAAGAGTATTAGATAATGTGCCAGACTATTTATCAGCTGGTCAGGCCTGTTGGGGACCAGATGACAGCATTGTATTTGTGGGTTGGTTCCATGAGCCATACAGACTTGGTCTGATCTATTGTCCCATGAGAAATTTAGAACAACTCAGCGACATCAAATATGCAGTGCACTCACCTCGCTTCAACCACAGCAAGGACAAGCTGATCTACTTTGCCCAGGATGTTGGAGGCACACATAATAAATGTGGAAGGTTGATGCAGTACGACTGGAAAACCAAAAGCACTTCAACTATTGTTGACGTCGTGGACATCCCTGAAAGAGGTGGATTTCCTGGGATCTACGTTCCTTGGTTGTTTTCAGACCGTAATTGCACGGAAGATGGGAAAAGCCTCGCCTTCACCACTGCATGGAGGAGTTACCAGAAAATTATTCTGGTTAATTGCAACGACAAGTCAGTGAAGGTCCTAACTACAACACCCGGTTGCTGGACTCTTCTCGATGTCAACAAAAACATAGTGTTAGCACAATTCTCGACACCGAACTCCGCTCCTAAACTTATGATTGCAGTTTTATCCGATGACGTTCCAGATGGCGGATTATCGTGGACACCTGTTGCACAAACCACCGACGACAGTCTTGAGAAAGAGATCGTATGGGAAGTAATGTCATTTTCACGGGACGAAAGTTCAGATTTCCAAGATGAATATGAAGCTATATTTCTGAGGCCTGTGGTGACAGACGAGAAGAAACTACCGTTAATTGTCTTCCCTCATGGAGGACCACACGTAAACTTCAAATCAGAGTTCTTCCTTCCCATCGTTTGCCTGTGCAAACTAGGATTCGCAGTGCTGTGTGTTAACTTCAGGGGTTCTGTCGGTTTTGGTCAAGCCTCCGTAAATTCGCTTCCTGGAAAAGTTGGAACCCAAGATGTCGGGGACGTGCAGCATGCAGCGAACAAGGTTCTGGAAAACTCCAGTGAGCTCGATAGTTCAAACGTCTTCGTTACTGGTGGCTCCCATGGGGGATTTTTGACTGCTCATCTCATTGGCCAATATCCGGGTTTCTACAGAGCGGCTGCCATAAGGAATCCTGCTCTCAATATAGCAGTGATGACCGAAATATCGGACATACCAGATTGGTGTCATTGCGAGGGAGGATACGAGTTTACTTATGACAGTACGCCAACACCTTTAATGATGTCGGAAATGCTGGAAAAATCTCCGTTTGTTTACATTTCACAGGTCAAAACTCCCACTGTAATATTCTTGGGAGCTGATGATATACGAGTTCCTCCAAGTCAAGGAAAGAATTTTTACAGAATCTTGAAAGCCCAAGGAGTTGAAACTAGGTTGCTATGGTACCCTGGTAATAGCCATCCCATCGCCAAAGTCGATGCTGAGAGTGATGTGTTTGTCAACATGGCTCGGTGGTTCTTTGAGCATTTACAAAACTTTGATATTTGTCCAAAGGCCGTTTACTTTGAGCTTAAGTTTTATATTTCACGGTCCGCCATTTCTCACGTCCAAAACTAG

Transcript

ANN13612-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P13676	Acylamino-acid-releasing enzyme OS=Rattus norvegicus OX=10116 GN=Apeh PE=1 SV=1
Q8R146	Acylamino-acid-releasing enzyme OS=Mus musculus OX=10090 GN=Apeh PE=1 SV=3
P13798	Acylamino-acid-releasing enzyme OS=Homo sapiens OX=9606 GN=APEH PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002419 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00326 all species →	Peptidase_S9	Prolyl oligopeptidase family	Domain	Interproscan
PF19283 all species →	APEH_N	Acylamino-acid-releasing enzyme, N-terminal domain	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001375 all species →	Domain	Peptidase S9, prolyl oligopeptidase, catalytic domain	Interproscan
IPR029058 all species →	Homologous_superfamily	Alpha/Beta hydrolase fold	Interproscan
IPR045550 all species →	Domain	Acylamino-acid-releasing enzyme, N-terminal domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR42776 all species →	SERINE PEPTIDASE S9 FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006508 all species →	Biological Process	proteolysis	Interproscan
GO:0008236 all species →	Molecular Function	serine-type peptidase activity	Interproscan
GO:0004252 all species →	Molecular Function	serine-type endopeptidase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01303	APEH; acylaminoacyl-peptidase	EC:3.4.19.1	Peptidases and inhibitors	ko01002	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora grisea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora grisea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →