Gene detail

Detailed information of ANN20780-RA in Montipora grisea

Genomic Location: Scaffold_19__1_contigs__length_4594208:917790...920549
NR annotation: EDY85469.1, SecD export membrane protein [gamma proteobacterium HTCC5015]
Species Montipora grisea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN20780-RA

ATGGATGAAAATGTCAAAGACAAGGCATTAGCAAAATTGAAGGCAGCTAACATTGAGTATGGCAAGGTTGAGCTTGATGAAAGCCAATTGCTGATTCGCTTTGCTGATACTGATCTGCAATTACAGGCCTACACTTTATTAAAAGATGATATGGGCAGTGACTTTGTAGTAGCCCAAAACTTAGCACCTGCGACACCAAGCTGGTTAAGAGCCTTAGGTGCACAACCCATGTACTTAGGTTTAGATTTGCGCGGTGGTGTGCATTTCTTAATGGAAGTGGACATGGATGAAGCGATTAAGCAAGACGAAGAATTGTTAATCGACGAACTTAAATTAGTGTTCCGTGAGCAAAAACTATACAACCGTGGTTTGCAACGTGCTAAAGGTCAAGGCATTAAAGTGTTATTTAGAGAAGCAAAATATCGCACTGAAGCCAAACAACTTCTAGCTAAAGATTACCAAGATTTAAAAGTAACTGAATTTGGTACAGCTGATCAGTATGGCTTACAGTTCGAGTTTACAGAAGAATCTTTAGTACAACGCCGTCGTGATGCGTTACAACAAAACATTACAACTTTACGTAATCGTGTCAATGAATTAGGTGTAGCTGAGCCTGTGATTCAACAGCAAGGCGAAGACCGTATTATTGTGCAACTTCCGGGTATTCAGGATACGGCACGTGCAAAAGAAATCTTAGGCGCGACAGCCAGTTTGGAATTCCGTTTAACTGAAGGTGATTATCAAGATTGGTTAGAAGCGGAAAATGGTGGCACGAAACCACGCGGCTCAAAGTTGTATCATCGTCGTGATGGCTCACCTGTATTATTGAAAAATAGTGTGATTGTATCTGGTGACCAAATTACCAATGCAACTTCTGGTTTCGATCAAAATAGTGGCTCGCCTGCAACCCACGTCACCTTGAATGGTAAAGGTGGTAAACGGATGTTAAAGACAACCACGAAGAATGTAGGCAAACCAATGGCGGTTGTATTCATTGAATATCAAATCGAATCAAAAATCATTAATGGTCAAACCATTAAGTCAACCAAGAAAAAAGAAGAAGTGGTTAATATTGCCACGATTCAAGAACCATTTGCGAATAACTTCCAAATCACGGGCTTAGGTGCAAAAGAAGCGACAAACTTAGCTTTGATTTTACGTGCAGGTGCGCTGAAAGCCCCAATGGAAATTGTCGAAGAACGCACAATTGGCCCAAGCTTGGGTAAGGAAAATATTGCTCAGGGTAAATTATCTATCATGATTGGTTTTATCGCAGTGATGATTTTCATGGTGTTGCGTTACAAAGTATTTGGCTTAGCGGCTAATGTGGCGTTATTGATGAACGTGGTGATTTTGATTGCCTTATTATCATTGTTACAAGCCACTTTGACTTTACCTGGAATGGCAGGGATTGTATTAACACTGGGTATGGCGGTAGATGCCAACGTGTTGATTTTTGAGCGTATCCGTGAAGAGTTAGCCAATAATAGTTCCCCACAAGCCAGTATTTTTGCAGGTTATGAAAAAGCCTTTGGTACGATTGCCGATGCGAATATCACCACTTTAATTGCAGCTGTGATGTTACTCAGTTTTGGTACTGGGCCTATTAAAGGATTTGCAGTGACTTTATCGCTAGGAAAGCGCAAAGTCGCGACGATTGTATCGACTATTTTGATGTTAATTGCATTGGCATCGCTTGGCTTGAAAGGCTTATCTTTTGGGATTGATTTCACAGGCGGTACATTGGTTGAAGTTCGTTATAGTGTACCTGTTGAATTGGATGAAGTGCGTGAGCTATTGCATTCCAATGGTTTTGAAGATGCTGTAGTACAAAACTTTGGTACAACTAAAGATGTGCTGATTCGTTTAGGCATCTATGAAAACATGAAAAATGAAGAAATCAGTAGCACTATTTTAGGTTTATTGCAGCAGCAAGATTCTGACGTGGTAATGAAGCGGGTTGAATTTGTTGGGCCTAAAGTAGGTGGTGAGTTGGTTGAAAAAGGTGGTATGGCCATTTTACTCACGTTATTCGGCATTTTGATCTACGTTACGCTACGTTTTGAATATCGTTTTGCTTTGGGTTCAATTGCCGCGTTAGTACATGATACTGTGATTACAGTGGGCTTTTTCTCATTATTGGGTTTAGAGTTTGATTTGACAGTATTGGCTGCGGTATTGGCGGTTATTGGTTACTCATTGAACGATACTATTGTCGTATTTGATCGTATTCGTGATAATTTCTTGAAGATGCGTAAACAAAACTCTGAGCAAGTGGTGAATCGATCTATCAACCAAATCTTAGGTCGTACGGTAATGACATCGGTAACAACTTTATTGGTATTGTTGGTGTTATTCTTCGCAGGTGGCGAGTTGATTCATAATTTTGCGATTGCTTTAATCGTCGGTGTGATTGTGGGTACTTACTCATCAATTTATATTGCGAGTGCTACAGCATTGTATTTAGGTATTAGTAAAGCAGACTTGATGCCTGTACAAAAAGAAGGCGCACAACAACAAGTTGACGAACGTCCTTAA

Transcript

ANN20780-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
E9RGS3	Protein translocase subunit SecD OS=Vibrio alginolyticus OX=663 GN=secD PE=1 SV=1
P0AG91	Protein translocase subunit SecD OS=Escherichia coli O157:H7 OX=83334 GN=secD PE=3 SV=1
P0AG90	Protein translocase subunit SecD OS=Escherichia coli (strain K12) OX=83333 GN=secD PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0012723 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13721 all species →	SecD-TM1	SecD export protein N-terminal TM region	Family	Interproscan
PF07549 all species →	Sec_GG	SecD/SecF GG Motif	Motif	Interproscan
PF21760 all species →	SecD_1st	Protein translocase subunit SecDF, P1 domain, N-terminal	Domain	Interproscan
PF02355 all species →	SecD_SecF	Protein export membrane protein	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR027398 all species →	Domain	SecD export protein N-terminal TM domain	Interproscan
IPR022646 all species →	Conserved_site	Protein-export membrane protein SecD/SecF/SecDF, conserved site	Interproscan
IPR005665 all species →	Family	Protein-export membrane protein SecF, bacterial	Interproscan
IPR022645 all species →	Family	Protein-export membrane protein SecD/SecF, bacterial	Interproscan
IPR005791 all species →	Family	Protein translocase subunit SecD	Interproscan
IPR048631 all species →	Domain	Protein translocase subunit SecDF, P1 domain, N-terminal	Interproscan
IPR022813 all species →	Family	Protein-export membrane protein SecD/SecF, archaeal and bacterial	Interproscan
IPR048634 all species →	Domain	Protein export membrane protein SecD/SecF, C-terminal	Interproscan
IPR000731 all species →	Domain	Sterol-sensing domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR30081 all species →	PROTEIN-EXPORT MEMBRANE PROTEIN SEC	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006886 all species →	Biological Process	intracellular protein transport	Interproscan
GO:0015450 all species →	Molecular Function	protein-transporting ATPase activity	Interproscan
GO:0005887 all species →	Cellular Component	plasma membrane	Interproscan
GO:0015031 all species →	Biological Process	protein transport	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K12257	secDF; SecD/SecF fusion protein	-	Secretion system	ko02044	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora grisea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora grisea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →