Gene detail

Detailed information of ANN21649-RA in Montipora grisea

Genomic Location: Scaffold_17__1_contigs__length_5665553:3331265...3333639
NR annotation: RKU37116.1, dihydroorotase [Candidatus Poribacteria bacterium]
Species Montipora grisea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN21649-RA

ATGAACGACGCGTTTATCGTTAACGGGCATATCATTGATCCAGCTAATAACATTGATGAAGCCGGCGGTCTCTTTATCGTTGATGGCAAAATTGTCCGAGTCGGTGGAAAGGAAGCACTTTCGGAATCCCACACGGCTGATGTATACGATGCGAAGGGGCTAATTGTCGCACCGGGATTGATCGATATGCACGTCCATCTCCGTGAACCCGGGTTTGAATATAAAGAGACAATTGCAACAGGCACGGCGGCAGCGGCAGCGGGCGGATTCACGTCGGTTGCTTGTATGGCAAATACAGCACCAGTAATAGATACGCCTGAAAAGATTGAGCAGATTTACGATATCGCGCGGGAAACTGGAACGACTAACGTATTCCCTTTTGGTAGTATTACCAAAAATCTTGCCGGTAATGAACTTGTAGATATGGCTGGGATGTATTCCGCGGGCGCAGTAGGCTTCAGTGATGACGGCGTTACCGTTATGAATGCTGCCCTCATGCGCGACGCACTCGCTTTGAGCGCAGAACTCGGTTTTCCAATTATGGTTCACTGTGAGGAGCACAATCTCAACGCCGGTGCTGTCATGAATTTGGGAGAAACTTCCCGAAAGTTGGGTCTCATTGGCAGTCCAAATGCAGCAGAGGACATTATCGTGGCACGCGACATCATATTAGCGGAAATGACAGGTGGACATCTCCATGTGCTTCACGTCAGCACGGCAGGTGCTGTTGAATTGGTTCGCCAAGGAAAAAAACGTGGCGTTCATGTAACGGCTGAGGCATGTCCACACCACTGGATCCTCACTGACACAGAGGTGGAAAAGCAGGGAACAAATGCCAGAATGCACCCACCCCTACGCACACAGAACGATATTGATGCAATTATCGAAGGTTTGCGAGATGGAACGATTGACGCCATTGCAACCGATCACGCACCACACGCACCTTGGGAAAAGGCATTGGGTATGCGTGATGCCCCTAACGGAATAATAGGCTTGGAAACGTGTTTACCACTTGTGTTTACATATCTTGTTCAGTCGGGACATCTTACATTGGTGGAGGCGATTGCAAAAATGACCGCGATTCCAGCGAATATACTCGGCGTCAATCGCGGCACTCTATCCGAGGGAGCAGTCGGAGATGTCACCGTTATTGATGTTGACTCGGTCAATCGGGTTGACGTAACAATATCTCGTTCAAAAAGTCAAAACACCCCTTTCGCAGGATGGGAACTTAAAGGCTGGCAAACGATTACACTCCCCGACGGAACAGTTTTTGAGGGTGAGCAGTTTGGCGCGATAGGCGAAACGGTCGGCGAGGTTGTCTTTAATACTAGTATGACGGGCTATCAGGAGGTATTGACCGATCCTTCCTACAAAGGGCAAATCGTCACGATGACCTATCCGTTGATTGGCAACTACGGCTGCAACGAAGCAGACATTGAATCCATCGGCCCACAGGTAGAGGGGCTTGTCGTGCGCGAATACAGTGCATATTATAGCAATTGGCGTTCAAAATGGAGTTTAGATGCTTACTTAGCAGAGCACGATATTGTCGGTATTCAAGGAATTGATACTCGCGCACTCACCCGTCGTCTCCGAGTACACGGCGTTATGAATGGTTGCCTCTCCACGGAGGATTTGAATACAGAGTCTCTTGTCACGAAAGCCAAAGCATGGCACGGCTTAGTCGGTTGGGATTTGGTGCAACGCGTGACGTGTCCGAATCCGTATGCATGGCAGCACCAAGAGAATAACAATGTCCACGCTAAACATCGTGTTATCGCCCTCGATTTTGGTATTAAATACAATATTCTGCGTCAACTCACCGAACATGGCTGCGAGGTCCAAGTCATGCCAGCAAAAACAACCGCTGAAGAGATTCTCGATGCGGAGCCAGATGGCGTGTTCTTATCAAATGGTCCAGGTGATCCTATGCCAGTCGGCTATGCTATTGAAACGATACAAGGATTAATGGGCAAAAAACCGCTATTCGGTATCTGTTTGGGTCATCAACTTTTAGGACTTGCCCTCGGAGGAAAAACGTTCAAACTGAAGTTTGGACATCGAGGTGCAAATCAGCCCGTCAAACACCTTGAGACCGATCGAGTTGAAATTACCTCACAAAACCACGGATTTTGTGTTGACATCGATTCGCTACCCAACAGCGTTGACATTACACACGTTAACTTAAATGATGACACACTTGAAGGGATACAACATCGGGAGTATCCCATTTTTTCTGTACAGTACCATCCGGAAGCATCCCCGGGTCCGCACGATGCCAGTTATCTCTTTTCGCGCTTCACAGAAATGATGGAGGAACGGAATCCTCAGTAG

Transcript

ANN21649-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q3A450	Carbamoyl phosphate synthase small chain OS=Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1) OX=338963 GN=carA PE=3 SV=1
Q7UGJ6	Carbamoyl phosphate synthase small chain OS=Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1) OX=243090 GN=carA PE=3 SV=1
P74587	Carbamoyl phosphate synthase small chain OS=Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa) OX=1111708 GN=carA PE=3 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001105 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01979 all species →	Amidohydro_1	Amidohydrolase family	Domain	Interproscan
PF00117 all species →	GATase	Glutamine amidotransferase class-I	Domain	Interproscan
PF00988 all species →	CPSase_sm_chain	Carbamoyl-phosphate synthase small chain, CPSase domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002195 all species →	Conserved_site	Dihydroorotase, conserved site	Interproscan
IPR029062 all species →	Homologous_superfamily	Class I glutamine amidotransferase-like	Interproscan
IPR006680 all species →	Domain	Amidohydrolase-related	Interproscan
IPR036480 all species →	Homologous_superfamily	Carbamoyl-phosphate synthase small subunit, N-terminal domain superfamily	Interproscan
IPR004722 all species →	Family	Dihydroorotase	Interproscan
IPR032466 all species →	Homologous_superfamily	Metal-dependent hydrolase	Interproscan
IPR006274 all species →	Family	Carbamoyl-phosphate synthase, small subunit	Interproscan
IPR002474 all species →	Domain	Carbamoyl-phosphate synthase small subunit, N-terminal domain	Interproscan
IPR017926 all species →	Domain	Glutamine amidotransferase	Interproscan
IPR035686 all species →	Domain	Carbamoyl-phosphate synthase small subunit, GATase1 domain	Interproscan
IPR050138 all species →	Family	Dihydroorotase/Allantoinase Hydrolase	Interproscan
IPR011059 all species →	Homologous_superfamily	Metal-dependent hydrolase, composite domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR43668 all species →	ALLANTOINASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016812 all species →	Molecular Function	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides	Interproscan
GO:0016787 all species →	Molecular Function	hydrolase activity	Interproscan
GO:0004151 all species →	Molecular Function	dihydroorotase activity	Interproscan
GO:0006221 all species →	Biological Process	pyrimidine nucleotide biosynthetic process	Interproscan
GO:0046872 all species →	Molecular Function	metal ion binding	Interproscan
GO:0004088 all species →	Molecular Function	carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity	Interproscan
GO:0006207 all species →	Biological Process	'de novo' pyrimidine nucleobase biosynthetic process	Interproscan
GO:0006541 all species →	Biological Process	glutamine metabolic process	Interproscan
GO:0004038 all species →	Molecular Function	allantoinase activity	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0006145 all species →	Biological Process	purine nucleobase catabolic process	Interproscan
GO:0016810 all species →	Molecular Function	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for ANN21649-RA.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora grisea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora grisea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →