Gene detail

Detailed information of ANN21775-RA in Montipora grisea

Genomic Location: Scaffold_17__1_contigs__length_5665553:5499463...5502647
NR annotation: MXY27434.1, glutamine--tRNA ligase/YqeY domain fusion protein [Candidatus Poribacteria bacterium]
Species Montipora grisea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN21775-RA

ATGAAGCATTCAGATCCCCCTGTGAAAGAAAACGCTGACAAACCTTCCGACACAAACTTTATCCGTCAAGAGATTAACGCGGACCTCAAGATAAACAGATATGATGGTCGGGTCCATACCCGATTCCCTCCAGAACCCAGCGGCTACCTCCATATCGGACACGCCAAGGCTATATGTATCAGTTTCGGTATTGCTGAGGATTATGGCGGACTTTACAATTTGCGGTTTGACGACAGCAACCCGATCACTGAGGAAAGTGAATACGTAGAAGCGATTAGACGGGATGTCCGTTGGCTCGGATTTGATTGGAAGGACCGAGAGTATCACGCTTCAGACTACTTTGAGACGCTCTACGAATATGCCGTCAAACTCACAGAAAAAGGAAAAGCTTACGTCTGTGATTTGACACCAGAAGAGACCCGCACCTATCGTGGCACTTTAGTTAAACCAGGGAAGGATAGTCCTTACCGGAACCGATCCATTGAAGAGAACTTGGAATTGTTCCGCGCGATGCGAGATGGCAAGTTCCCAGATGGTTTCTGTACACTTCGCGCAAAAATTGATATGACGAGTCCGAACCTGAATATGCGCGATCCGGTGATGTATCGTATTCTGAGGGCGCATCACCACCGACACGGGGACAAGTGGTGTATCTATCCTACCTACGATTTCACGCATGGGCAATCTGATTCGATTGAAGGTGTAACACACTCACTTTGCGACGTTCAGTTTGAGGATCATCGTCCCCTCTACGATTGGTTCTTAGAATCCTTGGAGATCTATCAGCCTCGACAGATCGAATTCGCACGGTTGAATCTTACTTATACCATACTGGGCAAGCGCAAACTCAAAGTCCTCGTTGAAGAGGGACACGTTAGTGGATGGGACGATCCGAGGTTACCCACGCTTTCTGGGATGCGCCGTCGGGGCTATACACCTGAAGCCATCCGAGATTTTTGTAGCCGCATCGGCGTTTCAAAGGCTGATAACCTCATTGAGATCGGGCAGCTTGAGTATTCTATTCGGGATGACCTAAATCAACGTGCTCCACGCGTCATGGCTGTTCTCAACCCGGTTAAGGTGGTTATTGACAACTATCCAGAGGGGCAGGTCGAAATGCTGGAAGCTGAGAATAATCCTGAAGATGAAAACGCAGGGACACGAGAAGTTCCATTCTCACGAGAAATTTATATTGAGCGTGAAGATTTTATGGAGGATCCGCCTCGAAAATTCTTCAGGTTGGCCCCCGGGCGAGAGGTACGACTGAAGCACGCCTATTATATCCAATGTGAACGGGTCGTCAAAAATGAAAACACCGGTGAAATCCTTGAGATTCACTGCACCTATGACCCAAAGACGCGGGGGGGCTGGTCGGAAGATGGACGCAGGGTCCGAGGAACATTACATTGGGTTTCGGCAGAACACGCTGTTGATGCTGAGGTGCGTCTCTACGATTCACTCTTTACAGAACGGGAACCGGAAGCACACGGGGCGGATTGGATACAATCCCTCAATCCGAAATCCTTAGAGGTTTTACGCAACTGCAAAGTTGAACCAGGGCTCGTTGATGCACCGTCCGAAAGCCGATACCAGTTTCTCCGCATGGGCTATTTTTGTGTGGATCCAGATACAACATCAGAGAAAACATCGGTTTCCGCTGTGAAAGATCAGGTTCGGGTTCGGATGGCACCGTCACCCACCGGTTACTTACACATCGGCGGCGCACGGACGGCACTATTCAATTGGTTATTTGCCAAACACCACAACGGCACCTTCATTCTCCGAATTGACGATACGGACATGGCGCGTTCCACTGATGAATCCATGCACGAGATTTACGAGGCCTTGAAGTGGTTGGGTATTGGTTGGAATGAGCACTATGTCCAGTCGGAGCGGCGAGGTCTCTACGACGGTTATGTTCAACGGTTGCTTGAGAGCAGCAATGCGTATCACTGCTACTGTACACCCGAGGAACTGGAGGGGATCCGCGCACAGGCTCGTGCCGATAAGCTGACTCGTTCCTACGACGGCAGATGCCAACACTTGACATCGGAAGATGTCCAACGCTTTGTCGACGAAGGTAGGAAACCGACTGTCCGGATAAAAATGCCCGACACACCTATTCTTGTTGACGACCTCGTTCTCGGTGCACGCAATATTGACCCCGCCACCTTAGAGGATGAAGTGATTGTGCGTTCAAATGGGATGCCGAACTACAATCTCACCTCGATTATCGATGACGCCGAGATACAAATAACGCACGTCATTCGGGGAACGGAGCATCTCAACAATACGCCCAAGCAAATCGCAATTGCGAATGCCCTCGAGCTAAAGATTCCGCAATTTGCGCACATTCCGCTGGTGCTGGATAGTGGTGGTAGGAAGATGAGCAAACGGCATCACGGCGATCTTGTCGCTGTTAACCGCTACCGTGAGCAGGGGTATTTGCCTGAAGCGATGCTGAATTTCGTTGTCCGTCTTGGCTGGTCCTATGACGACAAACAAGAGATATTCTCTGTTGATGAACTCATAGAGAAATTCGATCTCGCACGGATTGGAAAAAGTGGCAGCGTTTTCGATATTAAGAAACTGGAATGGCTCAACTCTCACTATATTAATCAACTCGATATCGCAGCGCGGACAGACGCGGTGATCCCATTCTGGCAAGAAGAGGGTTTATTGGATTCGACAGAAGATCGCGGCTGGTTGGAAAGTATTGTGGAGGCAGTAGGCGAACGCCTCACAACCCTACAAGACATCATTCCGCAGACTCGCTATTTCTTTACGGATGCATTTGAATACGATTCGAAAGCGGTAAAGAAATGGTGGGGAAATTCGGAAGAAAAAAAAGAAAAAACGCGCGAGATTCTAACGAATGTCTCACAGATTTTAGAAGAAATTCCTGCTTTCGACCTGCAAACAATTGAATCGGCAATTTGGAAATATACCGATGAGAACAACATCAAACGCGTCGCGGCGATGCAAGCGTTGCGAGTCGCTCTGACAGGAACGTCGTTTGGACCGAGTCTCTTTGATATTGTTGTCCTGCTCGGCAGAAACGAGGTCTTAAAACGGGTCCCAGAGGCAATAGAGCATTTATGA

Transcript

ANN21775-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q0SVB1	Glutamine--tRNA ligase OS=Clostridium perfringens (strain SM101 / Type A) OX=289380 GN=glnS PE=3 SV=1
Q7UX42	Glutamine--tRNA ligase OS=Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1) OX=243090 GN=glnS PE=3 SV=1
Q8XMP3	Glutamine--tRNA ligase OS=Clostridium perfringens (strain 13 / Type A) OX=195102 GN=glnS PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002706 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF20974 all species →	tRNA-synt_1c_C2	tRNA synthetases class I (E and Q), anti-codon binding domain	Domain	Interproscan
PF19269 all species →	Anticodon_2	Anticodon binding domain	Domain	Interproscan
PF03950 all species →	tRNA-synt_1c_C	tRNA synthetases class I (E and Q), anti-codon binding domain	Domain	Interproscan
PF00749 all species →	tRNA-synt_1c	tRNA synthetases class I (E and Q), catalytic domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR014729 all species →	Homologous_superfamily	Rossmann-like alpha/beta/alpha sandwich fold	Interproscan
IPR004527 all species →	Family	Glutamate-tRNA ligase, bacterial/mitochondrial	Interproscan
IPR033910 all species →	Domain	Glutamyl-tRNA synthetase	Interproscan
IPR008925 all species →	Homologous_superfamily	Aminoacyl-tRNA synthetase, class I, anticodon-binding superfamily	Interproscan
IPR020751 all species →	Homologous_superfamily	Aminoacyl-tRNA synthetase, class I, anticodon-binding domain, subdomain 2	Interproscan
IPR049437 all species →	Domain	tRNA synthetases class I (E and Q), anti-codon binding domain	Interproscan
IPR011035 all species →	Homologous_superfamily	Large ribosomal subunit protein bL25/Gln-tRNA synthetase, anti-codon-binding domain superfamily	Interproscan
IPR050132 all species →	Family	Glutamine/Glutamate--tRNA Ligase	Interproscan
IPR001412 all species →	Conserved_site	Aminoacyl-tRNA synthetase, class I, conserved site	Interproscan
IPR020056 all species →	Homologous_superfamily	Large ribosomal subunit protein bL25/Gln-tRNA synthetase, N-terminal	Interproscan
IPR045462 all species →	Domain	Aminoacyl-tRNA synthetase, class I, anticodon-binding	Interproscan
IPR020059 all species →	Domain	Glutamyl/glutaminyl-tRNA synthetase, class Ib, anti-codon binding domain	Interproscan
IPR000924 all species →	Family	Glutamyl/glutaminyl-tRNA synthetase	Interproscan
IPR020058 all species →	Domain	Glutamyl/glutaminyl-tRNA synthetase, class Ib, catalytic domain	Interproscan
IPR022861 all species →	Family	Glutamine-tRNA ligase, bacterial	Interproscan
IPR004514 all species →	Family	Glutamine-tRNA synthetase	Interproscan
IPR020752 all species →	Homologous_superfamily	Glutamate-tRNA synthetase, class I, anticodon-binding domain, subdomain 1	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR43097 all species →	GLUTAMINE-TRNA LIGASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000166 all species →	Molecular Function	nucleotide binding	Interproscan
GO:0004818 all species →	Molecular Function	glutamate-tRNA ligase activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0006424 all species →	Biological Process	glutamyl-tRNA aminoacylation	Interproscan
GO:0008270 all species →	Molecular Function	zinc ion binding	Interproscan
GO:0000049 all species →	Molecular Function	tRNA binding	Interproscan
GO:0006412 all species →	Biological Process	translation	Interproscan
GO:0004819 all species →	Molecular Function	glutamine-tRNA ligase activity	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0006425 all species →	Biological Process	glutaminyl-tRNA aminoacylation	Interproscan
GO:0004812 all species →	Molecular Function	aminoacyl-tRNA ligase activity	Interproscan
GO:0006418 all species →	Biological Process	tRNA aminoacylation for protein translation	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0043039 all species →	Biological Process	tRNA aminoacylation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01885	EARS, gltX; glutamyl-tRNA synthetase	EC:6.1.1.17	Prokaryotic defense system	ko02048	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora grisea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora grisea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →