Gene detail

Detailed information of ANN22171-RA in Montipora grisea

Genomic Location: Scaffold_18__1_contigs__length_5111168:2774426...2776684
NR annotation: MCG9130279.1, biosynthetic-type acetolactate synthase large subunit [Candidatus Poribacteria bacterium]
Species Montipora grisea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN22171-RA

ATGGAACTTTCAGGAGCACAAATCCTGGTTGATGGTCTCAAGCGGGAAGGTGTCGAATATATCTTCGGTGTGAACGGCGGTGCGGCGATGCCGATTTTCGATGCCTTGTACGGTGAGACCGAAATTAAATTGATTCCGATGCGGCATGAGCAAGGAGCTTCCCACGCCGCTGATGGCTACGCACGCGCCACTGGAAAAGTCGGTGTTGTGCTCGCAACTTCCGGTCCCGGCGCAACCAATCTCGTTACCGGGATCGCAACAGCCTATATGGATTCCATTCCGATGGTTGCGATCACTGGACAGGTTTTCACCCACTATATCGGCAGTGATGCCTTCCAAGAGTGCGATGTTATCGGCGTAACACGCCCCATCTGTAAGCACAGTTACCTCATTAAAAGCAGTGACGAAATCGCAAATGTTGTCGCTGAAGCGTTCCACATCGCGAAAACTGGGAAACCCGGGCCTGTTATTATTGACATCGCCAAAGATGCACAGCGGAATGAAGCGCTGTTTCAGTATCCAGAAACGGTTGATATCCGCAGCTACAAACCACAAGTACATGGCGATCCAGACCAAATTGCAAAGGCGGCGGCACTGATTAAAGAAGCTAAATGCCCCATGCTTTATGCCGGTGGTGGTGTAGTCCTTGCAAACGCCAGCGAAGAACTACGGCAGCTTGCCTTGAATACACAAATCCCGATTACTGTTACTTTGATGGGGCTTGGCGCGTTCCCTGAGACGCATCCGTTGGCGATGGAGATGCCCGGCATGCACGGTTCTTGTTGCGCAAATTACGCCTTCACCGATTCAGACCTCATTATCGCTGTCGGTGCAAGATTCGACGACCGCGTTACAGGTGATCTCAGCAAATTCGCACCCAACGCCAAGAAGATCCACATTGATATTGACGCGTCTTGTATCGGGAAAAATGTCCCTGTTGATGTCCCAATCGTCGGCGATGCAAAGAACGTTCTAACGGAACTGAACAAACAGGTCAGTACGGTGGATATCGACCCGTGGCGCAACCAAATCCAAGAATGGAAGCAGAAATACCCGTTTGAATACGAGCAGAAAGCTGATGTTGTCATGCCGCAGTACGTCATTGAGAAAATTTATGAGCATTATAGTGATGCAATTGTTGTGGCAGATGTCGGGCAACACCAGATGTGGGCGGCGCAATACTTCAAATTCACTGAACCCCGACAATGGCTCAATTCCGGCGGTCTCGGCACGATGGGTTTTAGCCTCCCAGCCGCAATCGGGGCACAACTCGGATGTCCAGACAAAGCCGTCGTCAACATCAACGGTGACGGTTCCTATATCATGACGATCCAAGAATTGGTGCCAGCGGTTACGATGAAGCTACCCCTTAAGGTCTTCATCATCAACAATATGTACCTCGGAATGGTACGGCAGTGGCAGGAATTGTTCCACGGCAAACGCTATTCCGCCGTCGATTACCATGACAACCCCGATTTCGCCTTGCTCGCACAGGCGTTCGGTGCCACAGGCTTGCGGGTCGAACACCCCGAAGATGTCGAACCCGCACTGCAGAAGGCAAAAGGAATTACCGACGGTCCCGTCGTCATTGACTTTATTGTTGATGAAGAGGAAAACGTGTTCCCAATGGTACCAGCCGTCGAAAACCGATTCGGAGTCCTCGCACGCGTTGCAGGACTTTTTAGCGGACGCGGCTTTAATATTGACAGTCTCAACGTCGCTGAGACACATGACAAAAGTATCTCGCATATTACGCTTGTCACGCACGGGGACGCGCAGATCATTGATCAGATTTACCAACATCTAAACAGACTCATTGACGTTATTGAGGTAACCAACCTCTCCACTGCTGGAACGCATGTTGAGCGCGAGCTTGTGCTTATCAAGATTGCTACCGATGATCCTCAAAAACGGACCGAGATTCTACAAGTCGCGGAAGTTTTCCGGGGGCGGGTTATAGATATGAAACCTGCCTCCCTTGTCCTTGAAATTACAGGGGATGAAGGTAAATTGAAAGCAGCAATAGATATTTTCAATACATACGGTATCCTTGAATTAGCACGCACCGGCAAAATAGCGATGCTGCGTGGATCCGAAAAATGA

Transcript

ANN22171-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P42463	Acetolactate synthase large subunit OS=Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534) OX=196627 GN=ilvB PE=3 SV=1
P9WG40	Acetolactate synthase large subunit IlvB1 OS=Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh) OX=83331 GN=ilvB1 PE=3 SV=1
P9WG41	Acetolactate synthase large subunit IlvB1 OS=Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) OX=83332 GN=ilvB1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0010661 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02775 all species →	TPP_enzyme_C	Thiamine pyrophosphate enzyme, C-terminal TPP binding domain	Domain	Interproscan
PF13710 all species →	ACT_5	ACT domain	Domain	Interproscan
PF02776 all species →	TPP_enzyme_N	Thiamine pyrophosphate enzyme, N-terminal TPP binding domain	Domain	Interproscan
PF00205 all species →	TPP_enzyme_M	Thiamine pyrophosphate enzyme, central domain	Domain	Interproscan
PF10369 all species →	ALS_ss_C	Small subunit of acetolactate synthase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000399 all species →	Conserved_site	TPP-binding enzyme, conserved site	Interproscan
IPR029061 all species →	Homologous_superfamily	Thiamin diphosphate-binding fold	Interproscan
IPR045865 all species →	Homologous_superfamily	ACT-like domain	Interproscan
IPR004789 all species →	Family	Acetolactate synthase, small subunit	Interproscan
IPR011766 all species →	Domain	Thiamine pyrophosphate enzyme, TPP-binding	Interproscan
IPR012846 all species →	Family	Acetolactate synthase, large subunit, biosynthetic	Interproscan
IPR045229 all species →	Family	Thiamine pyrophosphate enzyme	Interproscan
IPR012001 all species →	Domain	Thiamine pyrophosphate enzyme, N-terminal TPP-binding domain	Interproscan
IPR039368 all species →	Domain	Acetolactate synthase large subunit, TPP binding domain	Interproscan
IPR027271 all species →	Homologous_superfamily	Acetolactate synthase/Transcription factor NikR, C-terminal	Interproscan
IPR029035 all species →	Homologous_superfamily	DHS-like NAD/FAD-binding domain superfamily	Interproscan
IPR002912 all species →	Domain	ACT domain	Interproscan
IPR039557 all species →	Domain	AHAS, ACT domain	Interproscan
IPR012000 all species →	Domain	Thiamine pyrophosphate enzyme, central domain	Interproscan
IPR019455 all species →	Domain	Acetolactate synthase, small subunit, C-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR18968 all species →	THIAMINE PYROPHOSPHATE ENZYMES	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000287 all species →	Molecular Function	magnesium ion binding	Interproscan
GO:0030976 all species →	Molecular Function	thiamine pyrophosphate binding	Interproscan
GO:0009082 all species →	Biological Process	branched-chain amino acid biosynthetic process	Interproscan
GO:1990610 all species →	Molecular Function	acetolactate synthase regulator activity	Interproscan
GO:0003824 all species →	Molecular Function	catalytic activity	Interproscan
GO:0003984 all species →	Molecular Function	acetolactate synthase activity	Interproscan
GO:0050660 all species →	Molecular Function	flavin adenine dinucleotide binding	Interproscan
GO:0005948 all species →	Cellular Component	acetolactate synthase complex	Interproscan
GO:0009097 all species →	Biological Process	isoleucine biosynthetic process	Interproscan
GO:0009099 all species →	Biological Process	L-valine biosynthetic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01652	E2.2.1.6L, ilvB, ilvG, ilvI; acetolactate synthase I/II/III large subunit	EC:2.2.1.6	Pantothenate and CoA biosynthesis	ko00770	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora grisea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora grisea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →