Gene detail

Detailed information of ANN22420-RA in Montipora grisea

Genomic Location: Scaffold_27__1_contigs__length_2138198:1487399...1490678
NR annotation: EAW32407.1, hypothetical protein GP2143_14166 [marine gamma proteobacterium HTCC2143]
Species Montipora grisea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN22420-RA

ATGGAATCGTCAATTCAGACCGTAAAGCGCTATAGCAAGGAAAAGTTTAGTGCAGATTTTGTGGCTGCGCTTATTGTATCATTCATTCTTATTCCCCAGAGCTTAGCCTATGCGCTACTCGCCGGAGTGCCTGCTTCACTGGGACTCTATGCAAGCATATTGCCTTTGATTGTGTATGGCCTGATTGGCACCAGTTCTTGTCTCGCTGTTGGTCCAGTAGCCATTACTTCCTTATTGACCGCTACGGTAATTTCCCGGTTCGCACAAGAGCAGCCTGAACTCTATATAACGGTAGCAATAACGCTGTCGTTTGTCTGCGGCATGATCTTACTGCTTATGGGGCTCTTTAAGCAGGGTTGGATAACCCATATGCTGTCTCACCCGGTTGCTTCTGGATTCGTATCTGCTTCCGGTATTCTTATTATATTGAGCCAGGCAGAGCATTTTTTAGGAGTCCCGATTGATGGCAGAAATCTGATTAGTTTTGTTCACGATTTTTGCAGAGTCTTGAATAGTATTGACGTCGTCGCGTTTAGCATTGGTCTTCTTTCGCTGATTTTCCTAATTTTAGTACGAACGTGCTTAGAGCCTTTTTTACTAAAGCGTGTTGGATATCAAAATATAATTGGAATTCTCATAAAATCGTCGCCGCTTTTTGTTATTTTCATCAGCACAGCCGCCGTTTTTCTATTGAGCCTTGAAGAAAATGGATTAAGTATCGTTGGAGAAGTACCTCAGGCGCTACCGGAAATAGCTATACCCGCCATCGACATTAACCTTGTAGTATCAATTTTCCCTTCGGCAATACTAATTGCTCTTGTTGGCTATGCGGAGTCAATATCGGTAGCACAGAATTTAGCCGCCAAGCGTCGCGAGAGCGTCGATCCTAATAGAGAATTCCTGGGATTAGGAGCAGCTAACGTTGTTTCAAGTATTTCTGGCAGTTTTCCTGTTATGGGAGGCTTCGGGCGAACGATGATAAACTATGATGCCGGAGCTCAAACGCGATTCGCCGGCGTAATAACAGCACTGTTTGTAGTCGTAGTCGTATTATTTCTTACTCCGTTGTTCTACTTTTTACCCAATGCCACCCTGGGTGCAATTATTGTAGTTTCTGCCTGGTACCTGATTGATATTTGGGCCTTTAAACAGATTCTGGCATACAACCAGCAAGACTTTGCAACAATGATTATTACTGTCGTGGTAGTGCTGCTAGTTGGCGTGGCGGAAGGCCTGATTGCAGGAGTAAGCTCATCGGTTATTGCGTACTTATGGAAGACAAGCAGACCACACGTCGCTGAGGTTGGTTTGGTAGAGGGAAGCCAGCACTTCAGGAGTGTACTAAGGCACCGGGTTAGAACCTATCAGTCAATATTCTCACTACGCGTGGATGAGAACCTCACTTTTATCAATATGCCATACATTGAAGATCTGATATTTGACTATGCAATTCAGCACGACGACACACAACACGTGGTGATAATGTGTTCGTCAATAAATCACATTGATAGCTCCGCTCTGCAGGGACTAGTCTCACTCAATGAGCGTTTGATTGAAGTCGGGGTGATACTGCATCTTTCTGAGCTAAAGGGTTCCGTTTCCGATCAACTTGCAAATTCGGATTTCCTTATAAAGCTTACCGGAAATACAATGCGAAATCAGAAAATATCTATTGCAACGGTCATCGCGGCGACAAGCTTGACTTCTGGTATTACCGGAGTCGCTCACGCTGAAGGATTAGCGGACGCTATAAAGAACGGATCGGTTAGCGGAAACGTTCGTGCCTACTACAGCGCGCGGGATTTCGAAACTAAAACAGATGAAGATGCGTTTTCTATGGGGGGCGCGCTTCGTGCTGAAACGGCTCCCTTAGGGGCATTCCAGTTTGGTCTGGGTTATTATGCTGCGCAGGATTTGGATACTAATAGCTCTGACCCCGCAGAGGTCAACAAGCGCTTAGGCAGTGACGTTGAGGTTTTAGGGGAAGCTTATGTAAAAGCGAGCCTGTCTAATACTACGTTGACAGCCGGTCGGTTAAAGTTAAATACCCCGTTCGCGAATGCGGGTGACGCTTTTATAATTCCTTTCACCTTTGAAGGCGCAAGTATCACCAATAACAGCATATCTAATCTGACGCTGCAGCTTGCCCATATCAGTTCAATAAAAAATCGCAATAGCGATGAGTTTGTAGACGTAGGGCGTTGGTCGACGCAACGTTACGGCGTTGATTCTCAAGATACCGGTGGTACAACGACGTTGGGCGCTATCTACAACGCTAATGGGCTTAAACTCCAGGGTTGGTATTATGTATTTGACGAGTTATTTACCACATCCTATCTACAAGCAGACTATACGATTGATACAGATGGTGAGATAAAGCCCTTCATCGCTGCCCAGTATGGAGACCAAAGTGGCACCGGTGATGAGCTTATTGGTGATGTAGATTCGTCAATCTTTGGTATCAAGGCTGGCGCCAGTTACGGCAAGGCTAAGCTTACTTTCGCGTACAACAGTGTTTCAGATTCTGATGATTCCTTTGGTGGTGGCGCGTTTTTGGCCCCATACAACTTTTCCACCAGTCCGCTGTTCACAAACAACATGCTGGCAACCATGGAAAATGTAAACTCAGGTGACGCCTACAAGGTAACCTTTAATTACGGATTTAGTGCGGTGAAACTAAAATTGAGTTACGCGGAATTCGATTTTGATACAGCCACCAACAGAGAGGCCATAGACGCGGATATAATTTATAACATGGATCCCATTTTAAAGGGCTTAACCCTACGCTGGAGGCTGGAAGTTTTGACTGGCGATGTAAAATCTGTTGAGCAGGTTAATAATCGATTTCAGGTTCAGTTAACGTTTTAA

Transcript

ANN22420-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9FY46	Sulfate transporter 4.1, chloroplastic OS=Arabidopsis thaliana OX=3702 GN=SULTR4;1 PE=1 SV=1
Q8GYH8	Probable sulfate transporter 4.2 OS=Arabidopsis thaliana OX=3702 GN=SULTR4;2 PE=2 SV=2
A8J6J0	Proton/sulfate cotransporter 2 OS=Chlamydomonas reinhardtii OX=3055 GN=SULTR2 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001308 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03573 all species →	OprD	outer membrane porin, OprD family	Family	Interproscan
PF01740 all species →	STAS	STAS domain	Domain	Interproscan
PF00916 all species →	Sulfate_transp	Sulfate permease family	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR005318 all species →	Family	Outer membrane porin, bacterial	Interproscan
IPR002645 all species →	Domain	STAS domain	Interproscan
IPR001902 all species →	Family	SLC26A/SulP transporter	Interproscan
IPR023614 all species →	Homologous_superfamily	Porin domain superfamily	Interproscan
IPR036513 all species →	Homologous_superfamily	STAS domain superfamily	Interproscan
IPR011547 all species →	Domain	SLC26A/SulP transporter domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11814 all species →	SULFATE TRANSPORTER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0055085 all species →	Biological Process	transmembrane transport	Interproscan
GO:0005887 all species →	Cellular Component	plasma membrane	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for ANN22420-RA.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora grisea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora grisea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →