Gene detail

Detailed information of ANN22998-RA in Montipora grisea

Genomic Location: Scaffold_21__1_contigs__length_3404173:2875797...2878100
NR annotation: MXY93855.1, DNA translocase FtsK [Caldilineaceae bacterium SB0664_bin_27]
Species Montipora grisea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN22998-RA

ATGGCTGCCAGGAGGCGTAGACGAAGAAAATATCAGAAAAGTGGCCCAATGGCTGGATTCCATGCCACTCTGCAGAATCTGATCCGAAAGTTCGGCAGGGAGGCCTTGGGCCTAGCAGTCTTTGCGTTGGGTGGCTACCTCGGATTCTCGCTCTTCACATCGGGGCAGGGCTCCTGGGGCGCGATGCTGGCAGGCCGGATGGCATGGCCACTTGTTTTCAGCCTGCTGTTCACAGGCGCCGTAATGTTGTTGGGCCGGCAGGCCGGGTACTGGAATCCGGAAGCTCTGGTAGGAGCGGAGTTGCTGTTATTGTCGTTGGCATCACTGGAGTACATCCGAGACCACGAGGTGGCCGACTGGGCGATTCCGGCCGCCGGCGAAGTCGGCGGGCTGATAGGCTGGGGCACCGGCAATCTTCTGATCGGTCTGCTTGGTCAACTTCCGGCGGCTTTGTTCGCCGCTCTGCTTGTTGTGTCGAGCCTCTATCTCTTGTTCCGTAACACACCTCTAATATACGTGATTGGCCACTTGTCGCTGACGCGCCACCTGTTGGCGCGCTCGCCGGACAGTCCTTCCCAGCCATCCTCGTTTGACCAGGGAGAATCCGAACTGCTAGATGAAGAGGGGCACGCCGAAAAAAATTCGCAAGGTGAAAATTTCAATGCCGTGCCACTTCTCTCCGAGACAGAGGATGGCTCTACCGAACCGCATGCCTTCGCGCCGGAGCCGTCCGAAGTACTTCTGGCAGACCGTCCGATCCAGGCGGAGCTTCAGATGCCGGCGGCAGTGCCGGCCAGACGCAGGTCAAAGGGATCGGGACATAGTCCGCTCAAAATTACGCGCAAAAAGAAGGATTTACCCCACGGCGAACTATTGGATGACGATGGCGACCAGTTGCGGTGGGATATCGAGGGTATGGCAGCGATCATCCACGAAACTCTGTGGGATTTCGACATTCCGGTAGAGATCGTCAACATTGAGAGCGGGCCGACGATAACACAGTTCGGAGTGCAGCCTCTGTACATCGAACGGGCAGGCCAGAAGCGCAAAGTGCGTGTCAGCCGCATCGCTTCGGTAGCCGACGACCTTGCGTTGGCCCTGGCCGCGCCGGCCATCCGCATCGAAGCGCCGGTTCCGGGACAACCCTACGTAGGTATTGAAGTGCCCAACCCCGAAAAAACTATGGTGGGTCTCAAGGGGATCCTGCAGAGCAGACAAATGTCCCATCAAGGGGGAGTCCTGCCGCTAGCCATTGGGCGAGGGACGTCGGGACAGCCCATCGTCGCCGATCTGGCGCGCGCGCCGCATCTTCTTATCGCCGGCGCGACCGGTTCCGGCAAATCGGCCTGTATCAACGGCCTGATCGTCAGCCTTCTGATGTACCACGGACCGGAGAGCCTACGTTTCCTGATGGTCGATCCCAAACTGGTGGAACTCCACGGCTACAACCGCATTCCCCATATGATTGGCTGCGTGATTACTGACATGGAGGAGGTACACGGCGCGCTGACGTGGCTCTTGCTGCAGATGGATGACCGCTACAGCCTGTTCCGGACCCATAAGGTGCGAAATATCGCAGCGTTCAATGCCCTGGCCCGGCGGCGCAAGTTTTCTGCGCCGCTGCCCTATCTGGTCCTGATCGTGGATGAATTGGCCGATCTGATGATGACCGCGCCAGAAGAGATCGAAAGGCAATTGGTTCGCCTGGCGCAGATGGCGCGAGCCACCGGTATCCATCTGGTGCTCGCTACGCAGCGACCCAGCACCGATGTCGTAACCGGCCTGATCAAAGCCAACTTTCCCTCTCGCATCGCATTTGCCGTCACCAGCCAGGTAGACAGCCGCGTTGTCCTGGATTCGCCCGGCGCGGAAAAACTGCTAGGGCAAGGGGACATGCTCCTAATGCGGCCGGACAAGGCTAAGATCGAGCGAGTCCAGGGCAGTTACGTCAACGATGCAGAAATTAGGCGAGTGGTGGACTGGTGGCAGGAACGGAAAGGTTTGGAGAATCCCGGCGACCCCATGTCCCAGGTTGCGCCGTGGCTCGGACTCCTGGATCGGCTGGATGATGAAGATGAACTGCTGGCGGAGGCCGTCGATGCCATCCGCGGCGAGGAGACGATCAGCGCCAGCTTTGTGCAGCGCAAGTTGCGCATCGGCTATCCGCGTGCGGCGCGTCTCGTCTCTTTACTTGAAGCAAAGGGCGTAGTCGGCGCTGACCCGGGCGGCGGTCAAGGGCGCGCCGTTTTGCTCAAGGCAGAAAAGGAAACCAGGGAAGAAGACACGGCATTCGAGCAATTGTAG

Transcript

ANN22998-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8XJS8	DNA translocase FtsK OS=Clostridium perfringens (strain 13 / Type A) OX=195102 GN=ftsK PE=3 SV=1
Q895I8	DNA translocase FtsK OS=Clostridium tetani (strain Massachusetts / E88) OX=212717 GN=ftsK PE=3 SV=1
Q97I41	DNA translocase FtsK OS=Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W) OX=272562 GN=ftsK PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0013375 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01580 all species →	FtsK_SpoIIIE	FtsK/SpoIIIE family	Domain	Interproscan
PF09397 all species →	FtsK_gamma	Ftsk gamma domain	Domain	Interproscan
PF17854 all species →	FtsK_alpha	FtsK alpha domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036388 all species →	Homologous_superfamily	Winged helix-like DNA-binding domain superfamily	Interproscan
IPR002543 all species →	Domain	FtsK domain	Interproscan
IPR036390 all species →	Homologous_superfamily	Winged helix DNA-binding domain superfamily	Interproscan
IPR018541 all species →	Domain	FtsK gamma domain	Interproscan
IPR041027 all species →	Domain	FtsK alpha domain	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR050206 all species →	Family	FtsK/SpoIIIE/SftA cell division and DNA translocation	Interproscan
IPR003593 all species →	Domain	AAA+ ATPase domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR22683 all species →	SPORULATION PROTEIN RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000166 all species →	Molecular Function	nucleotide binding	Interproscan
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K03466	ftsK, spoIIIE; DNA segregation ATPase FtsK/SpoIIIE, S-DNA-T family	-	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora grisea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora grisea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →