Gene detail

Detailed information of ANN23156-RA in Montipora grisea

Genomic Location: Scaffold_26__1_contigs__length_2154940:1838212...1842130
NR annotation: MCE2400214.1, acetyl-CoA carboxylase biotin carboxylase subunit [Candidatus Poribacteria bacterium]
Species Montipora grisea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN23156-RA

ATGACAACAGAACAAGCATCTGATCTACAGAACACGTTGGAAACTATGCTAAACCTTATCGCGACAGGTGATGACATCGTTGACCAACTTCTCAAAATTGAGCAGTTGTCTACAGACATTGAATTAACTGCCCCAACAATGCTTAAGCACTATCTTGAACCAACTGGGGATACTAAGGTGATCTGCACTGCCTCTGTTGAAGAACGACTACCCCGTTTTATGCGTGACCAGCACATACAAGATAGAGGATGGGTTACAGCCGAGTATTCAATGTTACCGCGTTCCACTTCTCAACGTATGCAACGCGAATCATCGCAAGGCAGGCTCGGCGGACGGACACAAGAGATACAACGACTTATTGGTAGATCACTCCGTGCTGCTGTTGACCTTGATTCATTAGGTGAAAGAACAATTTGGGTGGACTGTGATGTAATTCAAGCCGATGGCGGCACTCGTACCGCAGCAATTACAGGCGCGTTTTTGGCACTCTGGGACGCATGCAAAACGCTACAACACCAAGGGAAACTTGATGAACTGCCAATCTTAGACAACATCGCAGCAACAAGTGTCGGAATTATTGACGGAGTCCTTATGCTTGACCTCTGCTATTCCGAAGATTCTGCTGCCGATGTTGATATGAATATTGTAATGACAGGAAGTGGCAAGTTTATTGAGGTTCAAGGCACTGCTGAACAAAAACCATTTTCTCGTGAGGAATACGACAAATTACTTGATCTATCTGTTGACGGTATCCAACAATTGATCCGCTTACAGAACCGAATGATGCTTGAGAACCTTGATGAAGATTTTCCGGATGCGCCAGAGGTGATTGAGGACGGTGGCACCTATCAAGAAAATGCCGCAAAGAAAGCCACAGTTATCTCTGATTATACCGGACTCCGAACACTCGCTGATGATGCAGGATTAGAAGTTGACGCTCTCGGTGGTGCGCCAGGTGTTCATTCCAAACGATGGGCAGGAGATGATGCTACTGATGCTATCCGAATTCAAAAGTTGCTTGAGGCTTTAGATAGGGTTGATAATCGAAGTGCACGATTTATTGCGGCGATTGCTATAGCTGAATCTACTACATCTAAGAATAGTGATTTTGAAAGGAATACTTTAAAGCAGGCAAAAGATTCTTTGTCAGAAAGGGTACAAGTTGTGATAGGGAAATGCAAAGGACATATTACTTATGTACCTGCTGGAGACAGCGGCTTTGGGTACGACCCAATCTTTGTGCCTATTGGTTATGAGAAAACTTTTGCAGAATTAGACTGCCAACATGTGAAACCTGGAAAAGGCGGAGCGTTCGCTCGAACCAAGATTAAGCGTGTCCGCGACGGTGCGGTCCTTGACCGAACCTTTCGTGCGAGTGAAACTATTGAGACTGTACGTCTCAATGACCAGGAAATGCAATTCCTCTATAGTGAAGGCGGCATGTTATGGTTTATGGATAATGAAACTTTTGACCAACACGAACTTTCCGAAACACTTCTTGGGGATAGCGTAAAATACCTAAAAGAAGGTGAAACTGTAACGGTGAAAATGGACGCGTCCACACCGCTTGCAGTGGAACTGCCAACCTTTGTTGAACTCCAAATAGTTGAAACAGACCCCGGTTTACGAGGAGATACTGTCAGCGGTGGTTCAAAACCAGCAAAATTAGAGACTGAAGTTACTTCTGACCCACTCCTACAACGCCTTGAAGACCTCATTGCAATTGCGGAGAAATCGGATTTGTCAACGGTTCGAATTCGAGATGGTGAAGTTGAAATAGAAGTTTCACGTGGTACCGCGCAACCTGCATCAATCGCACCTACTATTACAAGTGTCGCCGCACCAACACTCGGCGCGGAAAACGAATCGGGTGACGACATAATTCGCTCACCTATGCCTGCTCGTTTTTATCGATCTCCAGGCCCCGATGAACCACCATTTATCGCAGTCGGTGATACTGTAACAGCAAGTGCTTCGTTAGCTACGCTTGAAGTAATGAAAACTTATAACGATGTTGAGGCTCCTTTCGATTGTGAAGTCCTTGAAATACTTGTTGAAGATGATGAAGAGGCTTTGCACGTCAAGCATGCCGATGAAGCGTATTGTATTGGCCCACCTCCTTCTACTGAAAGTTATCTTAAATACGCAAACATTACGGCTGTTGCTGACTTTGCAAATGTTGATGCGATTCATCCTGGGGCCGGGTTTCTTGCAGAAGATGCACAGTTCGCTGAAATTTGTGAGGCACACCAAATAAAATTTATTGGTCCTTCAATTGACGACCTCACTACCATGGGAGATAAAGTTCAAGCCCTTGAGACAGTTGCAAAGGCCGGTCTAAAACTTGTCCCAGGTAGTCAAAATAGAAAAAGAAAAAAAGAAAAAAAAGCCACCGTTGAAACAGCTGAAGAAGCTGCTGAACTCGCTGAAAAGATCGGATATCCAATTGGAATCAAGGCTTCGGCAGGTGGAGGTGGACGTGGTATTCGTATCGCAAACAATCGCCCCAGTCTCTTCAACCTATTTCACACGGCAAAAGCAGAAAGTGAAGCTGCCTTTGGCAACGGTGATGTCTACATCGAAAAATGGATTGAAGAAGCACGTCATATCGAAGTCCAAGTTTTGGGAGATACTCACGGTAATGTTGTCCATTTAGGTGAACGCGAATGTTCCATCCAACGTAAACAGCAGAAACTGCTTGAGGAAGCCCCTGCTGCATCCATTTCCCCTAAACTCCGTAGTGAAATCTGTAAAGCAGCCGTTAAAGCAGCGAAATCAATCGGATACTCAAATGCAGGTACAATTGAATTTGTTATTGATAAAGACGAAAATTTTTATTTTCTTGAGATGAATACACGAATTCAGGTGGAACATACTATTACTGAAAGTATCACCGGTATTGATCTAATCAAGGAACAGATTCGACTGGCAATGGGAGAGGAAACTCGGATACAACCAATCTGA

Transcript

ANN23156-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P49787	Biotin carboxylase 1 OS=Bacillus subtilis (strain 168) OX=224308 GN=accC1 PE=3 SV=3
Q06862	Biotin carboxylase OS=Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576) OX=103690 GN=accC PE=3 SV=1
B9HBA8	Biotin carboxylase 1, chloroplastic OS=Populus trichocarpa OX=3694 GN=POPTRDRAFT_831870 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0015554 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01138 all species →	RNase_PH	3' exoribonuclease family, domain 1	Domain	Interproscan
PF00289 all species →	Biotin_carb_N	Biotin carboxylase, N-terminal domain	Domain	Interproscan
PF03725 all species →	RNase_PH_C	3' exoribonuclease family, domain 2	Domain	Interproscan
PF00364 all species →	Biotin_lipoyl	Biotin-requiring enzyme	Domain	Interproscan
PF09285 all species →	Elong-fact-P_C	Elongation factor P, C-terminal	Domain	Interproscan
PF08207 all species →	EFP_N	Elongation factor P (EF-P) KOW-like domain	Domain	Interproscan
PF02786 all species →	CPSase_L_D2	Carbamoyl-phosphate synthase L chain, ATP binding domain	Domain	Interproscan
PF01725 all species →	Ham1p_like	Ham1 family	Domain	Interproscan
PF01132 all species →	EFP	Elongation factor P (EF-P) OB domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001059 all species →	Domain	Translation elongation factor P/YeiP, central	Interproscan
IPR001247 all species →	Domain	Exoribonuclease, phosphorolytic domain 1	Interproscan
IPR020568 all species →	Homologous_superfamily	Ribosomal protein uS5 domain 2-type superfamily	Interproscan
IPR008991 all species →	Homologous_superfamily	Translation protein SH3-like domain superfamily	Interproscan
IPR027408 all species →	Homologous_superfamily	PNPase/RNase PH domain superfamily	Interproscan
IPR012340 all species →	Homologous_superfamily	Nucleic acid-binding, OB-fold	Interproscan
IPR018336 all species →	Conserved_site	Ribonuclease PH, conserved site	Interproscan
IPR016185 all species →	Homologous_superfamily	Pre-ATP-grasp domain superfamily	Interproscan
IPR005481 all species →	Domain	Biotin carboxylase-like, N-terminal domain	Interproscan
IPR002381 all species →	Family	Ribonuclease PH, bacterial-type	Interproscan
IPR015847 all species →	Domain	Exoribonuclease, phosphorolytic domain 2	Interproscan
IPR000089 all species →	Domain	Biotin/lipoyl attachment	Interproscan
IPR013815 all species →	Homologous_superfamily	ATP-grasp fold, subdomain 1	Interproscan
IPR001249 all species →	Family	Acetyl-CoA biotin carboxyl carrier	Interproscan
IPR005479 all species →	Domain	Carbamoyl-phosphate synthetase large subunit-like, ATP-binding domain	Interproscan
IPR015365 all species →	Domain	Elongation factor P, C-terminal	Interproscan
IPR013185 all species →	Domain	Translation elongation factor, KOW-like	Interproscan
IPR011764 all species →	Domain	Biotin carboxylation domain	Interproscan
IPR002637 all species →	Family	RdgB/HAM1	Interproscan
IPR029001 all species →	Homologous_superfamily	Inosine triphosphate pyrophosphatase-like	Interproscan
IPR011761 all species →	Domain	ATP-grasp fold	Interproscan
IPR051602 all species →	Family	Acetyl-CoA Carboxylase Biotin Carboxylase Component	Interproscan
IPR036345 all species →	Homologous_superfamily	Exoribonuclease, PH domain 2 superfamily	Interproscan
IPR011053 all species →	Homologous_superfamily	Single hybrid motif	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR48095 all species →	PYRUVATE CARBOXYLASE SUBUNIT A	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003746 all species →	Molecular Function	translation elongation factor activity	Interproscan
GO:0006414 all species →	Biological Process	translational elongation	Interproscan
GO:0000049 all species →	Molecular Function	tRNA binding	Interproscan
GO:0008033 all species →	Biological Process	tRNA processing	Interproscan
GO:0009022 all species →	Molecular Function	tRNA nucleotidyltransferase activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0003989 all species →	Molecular Function	acetyl-CoA carboxylase activity	Interproscan
GO:0006633 all species →	Biological Process	fatty acid biosynthetic process	Interproscan
GO:0009317 all species →	Cellular Component	acetyl-CoA carboxylase complex	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0043043 all species →	Biological Process	peptide biosynthetic process	Interproscan
GO:0009143 all species →	Biological Process	nucleoside triphosphate catabolic process	Interproscan
GO:0047429 all species →	Molecular Function	nucleoside triphosphate diphosphatase activity	Interproscan
GO:0046872 all species →	Molecular Function	metal ion binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for ANN23156-RA.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora grisea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora grisea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →