Gene detail

Detailed information of ANN23371-RA in Montipora grisea

Genomic Location: Scaffold_25__1_contigs__length_2167126:938441...942071
NR annotation: MCE2431936.1, ATP-dependent zinc metalloprotease FtsH [Candidatus Latescibacteria bacterium]
Species Montipora grisea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN23371-RA

ATGTCCGTACAGAAAAGGGATCTTTTACATCGCGTTGAATCGTATATCGAAAAAGAACAACTCCTTATATCGGGCGATGGGGTGGTGGTAGCCCTGTCTGGCGGTCCTGACTCCGTCACCTTATTCGATCTGCTCCACCGCCTCAAATCGAGATGGCGCCTCACACTTTATGTCGCGCACCTCAATCATCAACTTCGCCCCAATGCCGAAACCGATGCCGCGTTTGTCAAACAGATCGCCCGAAACTATCCCGTACATATCGAAAAGGAAAATGTTGTGCAATGGGCAAAAGATAAAAAGCAATCTCTCGAAGAAGCAGCGCGCGATGCACGACGGGCATTTCTCGACACCATAAAACAAAAAACGGGCGCGAATCGGATCGCGCTCGGCCATACAAAAAGCGATCAGGCAGAAACCGTTCTGTTGCGCCTTGTTCGAGGTGCAGGTCTCACCGGGTTGGGGGGTATGCGTCCAATTTCAGGAGAATATTGGATTCGCCCCTTGCTCTCATTTTCCAGATCGGAAATTGAATGTTATGTACGCGCCCGCAATTTGCAGGTGCTGCGCGATGAAACAAATAGCGATCCAAAATTTCTGCGCAATCGCATTCGCACAGACTTGATTCCCCGCTTGCAAAAGGCATACAATCCCCAAATAGAGGACCTCCTCTCTCGCGCGGCAAACCTGCTGCAAAATGACGATGCACACCTCGAAAACATTGCGGAACAGGCATTTTTGGACACCCTTTTGTACCGCGATAAACGAAAATTTATCCTTGATGTTAGGCGGTTTTTCGGTTATCATATATCACTTCGGCGTCGCCTGATTCGGAAGGTGCTCTTTGCCCTTTGGCCCAGTGCCAAAGCCGTGCGTTTCCAGGCTGTTGAACGCATTCTCAAAATTGCTTCCAACCCTGGACACAGCGTTCAAATAACGCCAGAAATCTCAGCTTATCGCACGCCTGACACGCTTATTATTGCCCAGCCCGCCCGGGCCTTCTGCTTTTTGGTTGAACCCGGTGTGCCCCTCGATATCAACGGCAAATTCTCAATGAAAATATTGAACAACTGCGAGTGTCTGCGACCGGTGTACAACTGCTTCAGCAGGTCAAATACAGCGAATCACACCGTCTTTTTTGACTTGGATCACCTCCCTGGCCGGGCGTTATATCTCCGCTCACCGCGGCCGGGCGACTGGTTTCACCCTTTTGGCATGCGGGGGAAAAAAAAAGTTAGCAGACTGCTCGGCGACAGCAAAATTCCCCGCCCACTGCGCGGCGAAATACCACTGTTGGCGAGTCATTCGACCCTGAGATTGCGCCAGCAAGTCATCTATGATCACACAATGCGAAAAGAGGCATTTATGACCGATTCCAAAGACAGGGGCTCGAAACCGGACGAAGAAACACATCCGTCCGACGAGACGTCTGATCGCGCTCCCACACAGCCTGAAGATGACGCGCCTGAAAAGGAAAAAGAGCGACGTCCCAACTTGTCAGTGCTCAATCGGGATAATGCCGATCGCAATAGTGCTTCGGAGAATGGCAAATGGCCCTGGCGACACATCTCAAAACCACTGGCTTTCTGGGTCTTTTTTTTGTTGATCGTCATTTTTGCTTCCAAATTTTTTGGCAGTGCCCCGTCCAGCGATGTCGTGCTCAGCTACAAAGAGTACAAAATGCTCCTCGAAGAGGGAAAAATCCAGAGCGCGATTATTATTGAGAACGAATTTCACGGCCACCTCGTGGCGGAAGAACTCACCCCGCCAGGCCGAAGACAACAGCACACCTTTCGCGATTTTGTCGTTGACTTGGGCGTCGTGGATGCCACGACTATAGATGAGTGGCTCAAACACGGCATTGACTTTCGCTTTCAAAAACCCTCCAACTGGCTCAACTATTTTTTTAATTTTTTGCCCTGGATCCTATTCATAGGGCTTTGGCTTTTCATTTTGCGCCAGATGCAAGGCGGCCCCAAAGGCGCGTTTAGTTTTGGCAAAAGCAAGGCAAAGCTCGTCTCTGAAGAGAAAACCCAAATCACATTCAAAGACGTTGCAGGTGCCGAAGAAGCCAAGCAAGAACTACAGGAAATCATCGAATTTCTGAAAGATCCGCGCAAATTTCAACGCTTGGGCGGGCGCATTCCAAAAGGCGTACTCTTGGTTGGGCCTCCCGGCACGGGCAAAACGCACATGGCACGCGCTGTCGCCGGAGAAGCGGATGTGCCATTCTTTTTGATGAGCGGCTCAGATTTTGTCGAAATGTTTGTCGGCGTGGGTGCTTCGCGCGTGCGCGATCTCTTTGAACAGGGCAAAAATCACGCGCCTTGTATCATCTTTATCGACGAAATAGATGCTGTGGGGCGGCACCGCGGCGCGGGTATTGGCGGCGGTCACGACGAGCGCGAGCAAACCCTCAATCAACTTCTGGTTGAAATGGATGGTTTTGAATCCAAAGAGGGTCTCATCCTCATCGCAGCCACCAACCGCCCCGACGTACTCGACCCCGCGCTGTTGCGACCTGGGCGTTTTGACCGTCAGGTCGTGGTGGACCGTCCCGATGTCAGAGGGCGCGAAGGCATTTTGAAAGTCCACACCCGCAACACGCCGCTTTCCGACGACGTCAACTTACAGGTGTTGGCGCGCGGAACCCCGGGGCTTGCAGGTGCAGACCTCGCCAATCTGGTCAACGAAGCCGCGCTTTTGGCGTCGAGAAATAATCGAGACCGCGTAACCATGAACGACTTTGAAGATGCCAAAGACAAGGTCATGATGGGTGCAGAGAGGCGCAGTTTGGTCATTTCCGAAAAAGAAAAACGCCTCACGTCCTATCACGAAATTGGTCACGCGCTGGTTGCCAAACTCATACCGGAAAGCGATCCTCTGCACAAAGTGACCATCATTCCGCGCGGGCGCGCGCTCGGCGTCACACATACCCTGCCCATTGACGAGCGCCACACCTATCCTCAAAGTTATTGTGAAGCTGTTCTCGCTTATGCGCTGGGTGGCAGAATTGCCGAAAAACTCGTTTTTGGCGAAATTACAACAGGCGGGCAGCAGGACTACCGCATGGCCACCAATCTCGCCCGACAGATGGTTTGCGATTGGGGCATGAGTCCAAAACTCGGTCCCATTGCTTATGGGCAGCAAAACGACGAAATATTCCTCGGGCGTGAAATGGCACAACGTCGAGATCACAGCGATAGAGTGGCTGAAATGATCGACGAAGAAATCAAAAACTTCGTGCTCAAAGCCGAATCCCGCGCCGAACAATTGCTCGGCGATAACATCGACAAAGTTCACATCTTGGCCGAAGCATTGCTCGAATTTGAGACCCTCGACGATGTACAGCTCGACCAATTATTAGCGGGTAAAACCCTCGAAAAACCAGTGCCAAACAGGCGTGCAAAACATTTAGAAGAATCGGAAGATCAGGTCGCAGAAGAACAGGGAGCAACGGATCAAACACCGCAGAAGTCTGAACGAGAAAAACAGCCATCGGATGACTAA

Transcript

ANN23371-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
C1F8X6	ATP-dependent zinc metalloprotease FtsH OS=Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161) OX=240015 GN=ftsH PE=3 SV=1
A0L4S0	ATP-dependent zinc metalloprotease FtsH OS=Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1) OX=156889 GN=ftsH PE=3 SV=1
Q1D491	ATP-dependent zinc metalloprotease FtsH OS=Myxococcus xanthus (strain DK1622) OX=246197 GN=ftsH PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003157 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF17862 all species →	AAA_lid_3	AAA+ lid domain	Domain	Interproscan
PF01434 all species →	Peptidase_M41	Peptidase family M41	Domain	Interproscan
PF01171 all species →	ATP_bind_3	PP-loop family	Family	Interproscan
PF00004 all species →	AAA	ATPase family associated with various cellular activities (AAA)	Domain	Interproscan
PF11734 all species →	TilS_C	TilS substrate C-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR037219 all species →	Homologous_superfamily	Peptidase M41-like	Interproscan
IPR003960 all species →	Conserved_site	ATPase, AAA-type, conserved site	Interproscan
IPR041569 all species →	Domain	AAA ATPase, AAA+ lid domain	Interproscan
IPR012796 all species →	Domain	Lysidine-tRNA(Ile) synthetase, C-terminal	Interproscan
IPR012094 all species →	Family	tRNA(Ile)-lysidine synthase	Interproscan
IPR014729 all species →	Homologous_superfamily	Rossmann-like alpha/beta/alpha sandwich fold	Interproscan
IPR003593 all species →	Domain	AAA+ ATPase domain	Interproscan
IPR000642 all species →	Domain	Peptidase M41	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR011063 all species →	Domain	tRNA(Ile)-lysidine/2-thiocytidine synthase, N-terminal	Interproscan
IPR005936 all species →	Family	ATP-dependent zinc metalloprotease, FtsH	Interproscan
IPR012795 all species →	Domain	tRNA(Ile)-lysidine synthase, N-terminal	Interproscan
IPR003959 all species →	Domain	ATPase, AAA-type, core	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23076 all species →	METALLOPROTEASE M41 FTSH	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004176 all species →	Molecular Function	ATP-dependent peptidase activity	Interproscan
GO:0004222 all species →	Molecular Function	metalloendopeptidase activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0006508 all species →	Biological Process	proteolysis	Interproscan
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan
GO:0000166 all species →	Molecular Function	nucleotide binding	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0008033 all species →	Biological Process	tRNA processing	Interproscan
GO:0016879 all species →	Molecular Function	ligase activity, forming carbon-nitrogen bonds	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0030163 all species →	Biological Process	protein catabolic process	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K03798	ftsH, hflB; cell division protease FtsH	EC:3.4.24.-	Chaperones and folding catalysts	ko03110	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora grisea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora grisea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →