Gene detail

Detailed information of ANN23704-RA in Montipora grisea

Genomic Location: Scaffold_33__1_contigs__length_1257472:726807...729404
NR annotation: MBM3223330.1, NAD-dependent malic enzyme [Candidatus Tectomicrobia bacterium]
Species Montipora grisea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN23704-RA

ATGACAGGTCGGAGCAGCGTGCTCCGACCTGCGGCTTCAGGGGACAGCATGCAGGAAACGATTGTGTTCACGCAGGGCGTCGAGATGCCGCCCGATATTGTTGCGCTGGCGCGTGACATGGCGCCCGAAGGATTCCGCCTGCATCACTTGCCGGTCGGCACGCCGGACGGCGACATCGCCGCTGCCATGCGCGAAGCAGAGTACTTGCTGGGCTTTGTGCGGCACCTGCCCGACGAAGCGTTTACCGCGGCGACACGGCTCAAGCTGGTGCAGGTGCTGAGCGCCGGGTACGATCAGGTCAACCTCGCCGCGGCGCGGAAGGCGCGGGTGCCGGTCTGCTCGAACGGCGGCGCCAATTCGGTGGCGGTAGCCGAGCACGCCATCATGCTCATGCTGGCCGTGTACCGCAAGCTCGTCGCCCTGCACCAGAATGTGGCCGCCGGCAAGTGGCACACCGGCATCCCGCGCACGGTGAATATCTACGAACTGGCCGGCAAGACGGTCGGACTCATCGGTCTGGGCAACATCGGCCAGCAGGTGGCCCAACGGGTCGGGGCCTTCGACGCCAGCGTCATCTATTACGACGCCTTCCGCCGCAGCCCGACAACGGAAGAACGCCTCGGCGTGCGCTACGTACCACTGGAAACCCTGCTGGAAACCGCCGACGTGGTAAGCCTGCATGTGCCCCTCAACCACGACACCCGGGACCTGATTGACGCCACGGCGCTGGCCCGTATGAAGCCCAGGGCGATCCTGATCAACACCTGCCGCGGTGAGGTGGTCGATGAAGCGGCGCTCTTCGAAGCCCTTCAGCAAGGCCGTATCCTGGCCGCCGGGCTCGACACCCTGGCGCAGGAACCGACGGACCCGTCCAACCCGTTGCTCACCTTGCCCAACGTGACCCTGACGCCGCACAGCGCCGGCCCTACCGTGGACAGCTTCCGCAAGCGTTTCCACAACGGCTACGCCAACATCCGGCGCGTTGCCGCGGGCGAGCCGCCGCGGTGGACCGATTTTCGCTTTGCCCACGGCGTCGCCGTTCCGAGCGACGGCAAGCTGCCAGCAGACGCCAATGATCTCGTTTACCTGATTCAGATGGGAGGAAGTATGGCCGTAGATGTAACCCCAAGTGCGAGTTATAGCGTCACGGTGCGACTGGAAATCCGCAACCGCGCCGGCATGCTGGCCCGCATGACGGCAAAGGTGGCCGAGTTCGGCGGCGATCTGGGAGCGATCGATATCGTGTCGGTCGGCCAGGGCGTGATGACCCGCGACGTAACCATCAATTGCCGCGATATCGACCACGCCCAAACCCTCGTGCAGGCGCTCGACGCCATTGACGGCATCAAGCTCATTCATCACTCCGACCGCACCTTCCTCATGCACCTGGGCGGCAAGATCGAGGTGGTCAGCAAGGCGCCCATCAAGACGCGCGACGATCTCTCCATGGCCTACACGCCAGGCGTGGCGCGGGTGTGCATGGCCATCTACGACGAGCCCCAGGACGTGTACAACCTGACCATCAAGAAGAACACGGTGGCCGTCGTTACCGACGGCACCGCCGTGCTGGGCCTCGGCGACATCGGACCGGCAGGCGCCATGCCGGTGATGGAGGGCAAGTGCGCGCTGTTCAAGGAATTCGCTAACGTAGACGCCTTCCCGCTGTGCATCGACAGCAAGGACCCGCGCGTCATCGTGGATACCGTCAAGCGCGTCTCGACCGCGTTCGGCGGCATCAACCTGGAGGACATCGCAGCGCCGCGCTGCTTCGAGATCGAGGAGTGGCTGCAGAACGAAATCGACGTCCCGGTGTTCCACGACGACCAGCACGGCACCTCGGTGGTGACCCTGGCAGCGCTCATCAACGCGCTGTACGTCGTCAAGAAGGACATGCAGGACATCAAGGTGGTGTTCAACGGCGTCGGCGCCTCCGGCGTCGCCACCAGCAAGATCTTCATGGAGGAAGGGGTCACCAACATCATCGGCTGCGACCGCGCCGGGGCCATCTACCGGGGCCGCACCGAGAACATGAACTTCATGAAGGACTGGTACGCCTCGAACACCAATCCGAACCAGGAACAGGGCGCGCTGCTGGACGTCATCGAGGGCGCCGATGTCTTCGTGGGCCTGTCCGGTCCCGGCACCTTCACGGTGGACATGCTGCGCAAGATGAACCGTGACCCCATTGTCTTCGCAATGGCCAACCCGGTGCCGGAAATCATGCCCGAGGAGGCCGCTCCGCACGTGCGCATCATGGCCACCGGGCGGTCGGACTACCCGAATCAGATCAACAACGTCCTGGGCTTTCCAGGCATCTTCCGCGGCGCTCTGGATTGCTGCGCACGTGTCATCAATGACGAGATGAAGATGGCCGCGGCGCGCGCCATCGCCGAGGCGATCCCGCGCCACGAGGTGCACGAGGAATACATCATCCCCAGCGTGTTCAATCCAGCCGTGGTGCCGGCCGTAGCGAAAGCGGTCGCCGAGGCCGCGGCGCGCACCGGCGTGGCGCGCCGCCGGACGAAGGTGCTGGATAACGTTCGCACGCTGACGCGATAA

Transcript

ANN23704-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P16468	NAD-dependent malic enzyme OS=Geobacillus stearothermophilus OX=1422 PE=1 SV=1
O34962	Bifunctional malic/malolactic enzyme OS=Bacillus subtilis (strain 168) OX=224308 GN=ytsJ PE=1 SV=1
Q9ZDF6	Probable NADP-dependent malic enzyme OS=Rickettsia prowazekii (strain Madrid E) OX=272947 GN=RP373 PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0012643 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00389 all species →	2-Hacid_dh	D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain	Domain	Interproscan
PF13291 all species →	ACT_4	ACT domain	Domain	Interproscan
PF02826 all species →	2-Hacid_dh_C	D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain	Domain	Interproscan
PF00390 all species →	malic	Malic enzyme, N-terminal domain	Domain	Interproscan
PF03949 all species →	Malic_M	Malic enzyme, NAD binding domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR015884 all species →	Conserved_site	Malic enzyme, conserved site	Interproscan
IPR029753 all species →	Conserved_site	D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding domain conserved site	Interproscan
IPR006139 all species →	Domain	D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain	Interproscan
IPR002912 all species →	Domain	ACT domain	Interproscan
IPR006140 all species →	Domain	D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding domain	Interproscan
IPR036291 all species →	Homologous_superfamily	NAD(P)-binding domain superfamily	Interproscan
IPR037062 all species →	Homologous_superfamily	Malic enzyme, N-terminal domain superfamily	Interproscan
IPR045213 all species →	Domain	Malic enzyme, NAD-binding domain, bacterial type	Interproscan
IPR012301 all species →	Domain	Malic enzyme, N-terminal domain	Interproscan
IPR012302 all species →	Domain	Malic enzyme, NAD-binding	Interproscan
IPR051674 all species →	Family	Malate Decarboxylating Enzymes	Interproscan
IPR046346 all species →	Homologous_superfamily	Aminoacid dehydrogenase-like, N-terminal domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR43237 all species →	NADP-DEPENDENT MALIC ENZYME	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016616 all species →	Molecular Function	oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor	Interproscan
GO:0051287 all species →	Molecular Function	NAD binding	Interproscan
GO:0004470 all species →	Molecular Function	malic enzyme activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for ANN23704-RA.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora grisea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora grisea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →