Gene detail

Detailed information of ANN23813-RA in Montipora grisea

Genomic Location: Scaffold_31__1_contigs__length_1398629:340905...343523
NR annotation: RKU08500.1, hypothetical protein C6502_14910 [Candidatus Poribacteria bacterium]
Species abbreviation MGRIS · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN23813-RA

ATGAACGTCACCTGGTGGTTGGTTCCAAGTGGGCTCATTCTGATTCTTGCCGTTTGTATTTTGACTATCGTTGTCCGGCGGAGATACTCGCGTGCCCAAAAGCTTAATAATGAATACACTAAACCGATACATATTCTCACCCGCGAGTTAATCCATGAGATCCGCAATCCGTTAAATAGCATTAACCTTAATCTCCAAATTTTAGAAGAAGATTTATCTACTCAGAATCGTCGTTCCCCCAACGACTTGCAGAAGCGTGTCCGTCGTATTCGTGGGGAGGTGGAACGGCTAGATCGAATATTAACCGATTTCCGTCGTTATGCAAAATTACCACCGTTGACATTTGAAACCTGCGATCTCGCTGTGCTTATCGAAGAGGTTTTGGACTTCAACGAGCCGGAGGCACAAAGGCAAAAGGTTCAGGTCAATCGTGAGATCCAAAAGCTGCCTCCTGTTCAACTTGATCCATCGCAGTTTAAGCAGGCATTGCTGAATCTTATTATCAATGGGGTGCAGGCGATGGAAGATGGGGGTACGCTCACGGTTCGCGCAAAACCGTTGAATGGGGGGATACAGATCGATGTGGAAGATGCAGGGCAAGGCATCGAACCGGAGCAACTCGACAAAATCTTTGATCTGTTCATCTCTACAAAAGCGGAGGGGACCGGGGTCGGTCTCACGATCGTAAAACAGGTTATTGAGGGGCACGGTGGGCGTGTCAATGTGGAGAGCAAGCCCGTAGCAGTAGGTGATAAGATGATTCCAAAAATCCTTGTTGTAGACGATGATCGGGCAAGTGTCGAGGCTGTCATCGAAGTGCTTGAACGTGAAGGCTACGACCTATTTACAGCAGCAGGGGGGCGCGAGGCATTGGAGACTTTAGCCGCTGAAAATATTGATGTCGTCATCACCGATGAAAAGATGCCCGATTTGAGTGGGATAGATCTACTCAAGTACATAAAAGACAACCACCCCTATACACAAGTCATCATCTTAACAGGCTACGGCTCGATTGATAGTGCAGTTGAAGCCACAAAAGCAGGGGCAGATGGTTACCTCGAAAAACCGATACAAATTAACATCTTGCGGCAAACGGCGAAAAACGCACTTGAAAAACGGTCGCTCTTCCTCCAGAACGTCAATCTACGAGAACAGCTCGATGACAAGTTTGGATTTGCGAACATTATCGGCACGTCAAAACTGATGCGAGAGCTTTTCCGCATGATCCGGCTTGTTGCTCCGACCAATGTAACCGTCCTTATACGCGGGGAAAGCGGGGTTGGGAAGGAATTAATCGCGAACGCAATCCACAACCATAGCCGCCGAAAGGACAAACCGTATCGGACAATTAACTGCGGTGCGCTTTATCGTGAGCTACTGGAAAGTGAGCTATTCGGCCATGAACGTGGTGCTTTCACCGGGGCGACCGCCCGCAAATTGGGACTGTTTGAGCAGGCGAATGGCGGCACCCTACTGTTAGACGAGGTTGGGGAAATGGGGATTGAAACACAGGTGAAATTCCTCCGCGTGCTGGAAGGACATGAATTTACACGCCTCGGTGGGGATAGACCCATCAAAACCGATGTCCGTATCATCGCTTCGACCAATGCAGACCTCGAAGAGGCGGTGAACAACGGAAAATTCCGCAACGACCTTTATCACCGTATCAACCGATTTCCGATCCGGGTGCCGCCGTTAAGGGAACGACGCGAGGATATCCCCCTGCTGGTCAGCGCGTTCATCAAAGAGTTTAGCAAAGAACACGACCGCCCCATTTCAGAAATTACCCCCCAAGCGATGAATTACCTGAAAAATGCGGATTGGCTTGGAAACATCCGTGAGTTACGCAATGCCATCGAAACCGCCATCATTTTAGCACGGACGGAGACCCTTGAACTCGACGATTTCTCCGCCGAATTTCAAACGGGCTTCACGGATTCGGAGGTCGCTTTGGATCCCGATGCCCCGGGTAATCTGGAAAGTGCGGAACCCAAATCAGCGTTCCTTACGAACTCGGCTGATGAGAGGGTAGGAACGGTTGGAATGACGATGGAAGAGATCGAAAAAGAGGCTATCGGCAAGACGTTGGTGGAAACCGGCAATAACAAGAAGCGGGCGGCAGAAATGCTCGGAATCGGTTTACGGACGCTGTATCGAAAACTGGAATCTTACGGCTGGTTGAACAAAAGCAATCAAACGGATGAAACACGCAATTGA

Transcript

ANN23813-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P14375	Transcriptional regulatory protein ZraR OS=Escherichia coli (strain K12) OX=83333 GN=zraR PE=1 SV=2
Q9APD9	Transcriptional regulatory protein ZraR OS=Klebsiella oxytoca OX=571 GN=zraR PE=3 SV=1
Q06065	Regulatory protein AtoC OS=Escherichia coli (strain K12) OX=83333 GN=atoC PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006593 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00072 all species →	Response_reg	Response regulator receiver domain	Domain	Interproscan
PF02518 all species →	HATPase_c	Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase	Domain	Interproscan
PF00158 all species →	Sigma54_activat	Sigma-54 interaction domain	Domain	Interproscan
PF00512 all species →	HisKA	His Kinase A (phospho-acceptor) domain	Domain	Interproscan
PF02954 all species →	HTH_8	Bacterial regulatory protein, Fis family	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001789 all species →	Domain	Signal transduction response regulator, receiver domain	Interproscan
IPR003594 all species →	Domain	Histidine kinase/HSP90-like ATPase	Interproscan
IPR003661 all species →	Domain	Signal transduction histidine kinase, dimerisation/phosphoacceptor domain	Interproscan
IPR036890 all species →	Homologous_superfamily	Histidine kinase/HSP90-like ATPase superfamily	Interproscan
IPR025662 all species →	Binding_site	Sigma-54 interaction domain, ATP-binding site 1	Interproscan
IPR009057 all species →	Homologous_superfamily	Homeobox-like domain superfamily	Interproscan
IPR002197 all species →	Domain	DNA binding HTH domain, Fis-type	Interproscan
IPR003593 all species →	Domain	AAA+ ATPase domain	Interproscan
IPR002078 all species →	Domain	RNA polymerase sigma factor 54 interaction domain	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR025943 all species →	Binding_site	Sigma-54 interaction domain, ATP-binding site 2	Interproscan
IPR005467 all species →	Domain	Histidine kinase domain	Interproscan
IPR011006 all species →	Homologous_superfamily	CheY-like superfamily	Interproscan
IPR004358 all species →	Domain	Signal transduction histidine kinase-related protein, C-terminal	Interproscan
IPR036097 all species →	Homologous_superfamily	Signal transduction histidine kinase, dimerisation/phosphoacceptor domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR32071 all species →	TRANSCRIPTIONAL REGULATORY PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000160 all species →	Biological Process	phosphorelay signal transduction system	Interproscan
GO:0000155 all species →	Molecular Function	phosphorelay sensor kinase activity	Interproscan
GO:0007165 all species →	Biological Process	signal transduction	Interproscan
GO:0043565 all species →	Molecular Function	sequence-specific DNA binding	Interproscan
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0006355 all species →	Biological Process	regulation of DNA-templated transcription	Interproscan
GO:0008134 all species →	Molecular Function	transcription factor binding	Interproscan
GO:0016310 all species →	Biological Process	phosphorylation	Interproscan
GO:0016772 all species →	Molecular Function	transferase activity, transferring phosphorus-containing groups	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K07714	atoC; two-component system, NtrC family, response regulator AtoC	-	Two-component system	ko02022	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.