Gene detail

Detailed information of ANN24439-RA in Leptoseris scabra

Genomic Location: Scaffold_1__1_contigs__length_42512999:40790985...40803239
NR annotation: XP_027054171.1, E3 ubiquitin-protein ligase SH3RF1-like [Pocillopora damicornis]
Species Leptoseris scabra · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN24439-RA

ATGTCGATGATGGATCCAGTGCAATTGAACGAACTGTTAGAGTGTTCAGTATGCCTAGAACAGCTTGATCAAAGTTCAAAGGTATTACCCTGTCAACATACGTTCTGTAGAAGATGTCTGAAAGAAATCGTAGAAACAAGAAAGGAGTTAAGGTGCCCCGAGTGCAGAATTCTTGTCGAAGAAGACGTGGACAATTTGCCGGTGAATATTTTTCTCGTACGTATACTGGAAGGCTTGAATCGCGCCAAGGTAGGGATTTATAACAATTGGAGAATTATAACATATGTTTTCCGTAGTGAAATTCAGGTGAAGAAAGGTGTAATTAGTGGTGCACGATTTTTCGCACCTCAGCCATCTGCGAGAGCTTTGTATGATTATGAACCAAAGGAAGTTGGTGATCTAACATTGCGTAAAGGAGAGATCATAACCTTACTCAAACAAGTAGACGAAAACTGGTATGAAGGTCTGAGTAATGGCTGCCAAGGATATCTTCCAGCAAATTATGTTGAGGTGATCAATCCACTTCCAAGTCTAGATGATTCATTTGACAGGCCCATCGCCAAAGCATTGTTTGACTTTGAAGATGAACAAGAACAAGACTTACTTTCCTTTAAACAGGCAGACTTAATTAGTGTGATACGTCGAGTTGACGAAAACTGGTGTGAAGGAAAGCTGAATGGCAAGCTGGGTATTTTCCCAATAACATTTGTTGAGCTTAATTTAGCAGCAAGGAACCTTGTTGAGGGAGTAGAAAATGTTGAAGACCAAGCTGTAGGGAAACCGCCAAGAAAATCAGTGACACCTGATGCAAGCAAAGGAGAACCAAAACGGCATACCATGCATTTTGTTGGACAGCGAAATGAGGACAGTCAGCCTGTTGGAATTCAGCGGCGCTCTCTTGATATTTCATCATCTGAAAGGCTTGCAGATGCACTTGATAACTCAGCATCTCCAGCATCTGGTACATTCCAAAATAGACAGAACACATCCACTGGTAATAGTCCTTCTAACCGATCTCAGAGAACTGTTGGAGAATCCACCAGCTTGCGACGAGGATCTTCACCACCCTCTGTCAGTCAGGCTCAATCAGCTTCAGCAAGACATGGCTCACCTCATGAGCCCAACTCAGGATCACGACCAGCATCAGCAGAAATGGGAAAAGAATTATATGTTGCACTGTATAGTTACAAGCCCACTAAAGATGATGAATTAGAGCTGGTGAGAAATGAGAACTACTGTGTAACAGAAAAATGCAAAGATGGTTGGTTTAAAGGATATTGTGTGTCTACTCAGAAGAGGGGTGTCTTCCCTGGAAATTACGTGCGGCTTGCCAGTATTCACAATTTACTAACAAGATCAAGGAGCAGCAGTGTAGAGCAAGAGAAAGTCTTAAATCCAGTAACACATAACACTCAACCTCAACCTCCACCGCATCAAAGACCGCCTCCACCACGACACACTGTCTCAGAGGGGGGCTCTCACTCAAGATTCTGCCGGTCAGATTCCGCCCCAGCCTTCCCTCAGCAGCCAGTGATGCCAGTAGCAAGTCTGGTTGTTAATTTAAATCAAGGAAGAAATTTAGCAGAAAATAGAAATCTTGCTGACAGACCCTCGGAGAGAAGCAGATTTGTAGCAACATCGCCTCTCCCCCCACCACCAGCACCCAAATCGAGTGGTTTCTGGAAAAAGCTGACAGGCAAGAAGAAGGAAAGATCAAAAGCCAGCCCTCCTCCTCCCCCTCCCCCACCATATCAAAGAAGTATTCCTGCCGGACACAGTGCACTCTCTCCTCCACCCTACGATTTTACAGCGCTGACGCCATCTTCGTCTCAGACACCCAGGGGAGACGCTTCAAGGTCCCATCACAGAGTAGAGAACCCGCCAGTCAGCGAAAGGTATCGTGTTATTGTGGCGTACCCGCCTCAGCACGAGGCCGAACTTGAGCTTCGGGTTGGCGACGTTGTTTATGTAACAAAAAAGCGGCAAGATGGCTGGTACAAAGGGACGCTTGAGCGAAATGGAAAAACAGGCTTATTTCCAGGAAGTTTTGTCGACATGTTTTAA

Transcript

ANN24439-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6NRD3	E3 ubiquitin-protein ligase SH3RF1 OS=Xenopus laevis OX=8355 GN=sh3rf1 PE=1 SV=1
Q28E95	E3 ubiquitin-protein ligase SH3RF1 OS=Xenopus tropicalis OX=8364 GN=sh3rf1 PE=2 SV=1
Q8TEJ3	E3 ubiquitin-protein ligase SH3RF3 OS=Homo sapiens OX=9606 GN=SH3RF3 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006413 (this species only) · gene tree & orthology
Ubiquitin family	E3\|E3 activity RING\|RING · all ubiquitin genes in this species
Ubiquitin family	UBD\|Other\|SH3 · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00097 all species →	zf-C3HC4	Zinc finger, C3HC4 type (RING finger)	Domain	Interproscan
PF14604 all species →	SH3_9	Variant SH3 domain	Domain	Interproscan
PF00018 all species →	SH3_1	SH3 domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR013083 all species →	Homologous_superfamily	Zinc finger, RING/FYVE/PHD-type	Interproscan
IPR001452 all species →	Domain	SH3 domain	Interproscan
IPR035816 all species →	Domain	SH3RF1/SH3RF3, fourth SH3 domain	Interproscan
IPR017907 all species →	Conserved_site	Zinc finger, RING-type, conserved site	Interproscan
IPR018957 all species →	Domain	Zinc finger, C3HC4 RING-type	Interproscan
IPR036028 all species →	Homologous_superfamily	SH3-like domain superfamily	Interproscan
IPR001841 all species →	Domain	Zinc finger, RING-type	Interproscan
IPR028502 all species →	Domain	E3 ubiquitin-protein ligase SH3RF3, RING finger, HC subclass	Interproscan
IPR050384 all species →	Family	Endophilin/SH3RF	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR14167 all species →	SH3 DOMAIN-CONTAINING	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0046872 all species →	Molecular Function	metal ion binding	Interproscan
GO:0016567 all species →	Biological Process	protein ubiquitination	Interproscan
GO:0032436 all species →	Biological Process	positive regulation of proteasomal ubiquitin-dependent protein catabolic process	Interproscan
GO:0046330 all species →	Biological Process	positive regulation of JNK cascade	Interproscan
GO:0061630 all species →	Molecular Function	ubiquitin protein ligase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K12171	SH3RF, POSH; E3 ubiquitin-protein ligase SH3RF	EC:2.3.2.27	Ubiquitin system	ko04121	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Leptoseris scabra tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Leptoseris scabra, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →