Gene detail

Detailed information of ANN25128-RA in Montipora grisea

Genomic Location: Scaffold_161__1_contigs__length_177188:108660...114350
NR annotation: MCF8494129.1, RNA polymerase sigma factor RpoD [Rickettsiaceae bacterium]
Species Montipora grisea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN25128-RA

ATGGATGTTATTGTTTTGCATCAAGCAGGATTTAATCAAGCTGTAGCAAGCTTAGGTACTGCAGTTACTGATAATCACATACAAAAATTATGGCGTTCGGGAGATGAAATTATAGTTTGTTTAGATGGTGATAGTGCTGGTGCTAGGGCCATGACTAGGTTGATAGATATGTCTCTACCACATGTTACCTCCAATAAATTTATATCATTTGTTCAATTACCATCTGATACGGATCCAGATGATTTCATCAATGCTAATGGACCTAAAGCTTTTAAAGATATTCTTACAAGGCGTCTGGGTTTATCTGAGATGATATGGAAAAATGAATATACAGTTGATGAGCTTGAAGGTGCAATTTCAAAATTTTCTGAAGCTGGAGTTGATATAATTGAAGATGATAGTGAAGAAATTAAGCTTGATATTAATGTAAACCAAGAGCTGACTGTCTCAAATCGTTCAATTGAAGATTCTGATGAAGAAGAAAAAACTTCAGATAATATTGGTACTACTGATGACCCAGTACGATTATATTTGCGTGATATGGGAGGTGTAGAATTATTATCTCGTGAGAATGAAATTGAAATAGCAAAACGTATTGATGCAGGAAAAGAGTTGATGGTAAATTCTCTGTGTGAAAGCCCTATTGCAATGAAACGTTTCATTAAATGGTTCGAAGATTTAGTGAATGAAAAAATTTTATTACGAGATTTAATCGATCTTGAGGCGAATTTAGTTACGGACAATGATTTTACAGAATCAGAGGAAGGTTCATCAGATGATCAAAATGACTCTTCTGAAAAAGATCAAGAAGACACGACGTCTTTATCAATTGCTGCTATGGAGGCTGAATTATTACCTTCAATTACTGATAAAATGGAAGATATAGCAAAAGTTTGTGAAAAAATATTAGAAGAAATAAAGAAAAACTATAGTGTGCCATCAAAGGCAATTCCTCTTAAAGATAATAAAAAATATACAGTAGCTCTTGCTAGTTTAGTAGAAAAAGTTTCATCAATATATTTTAATACCAAGCGTATTGAAGAAATGTTAGTTGACATTTATGTTGTTAACAAGGCTCTTGTTAGTAAAGAAACACAATTATTAAAGTTAGCAGAAAAACATAAAGTCACTAGGGCAAGTTTTTTAAAAGAATATATTGGTGCAGAAATAGGTAATGCTTGGCTTGAAAAAGCGGCTAAGAAAAAAGAGGTTGCTTGGCAAAATTTCTTAAATGAGGAATCAGATGCAATAAACTTGTTATTTCAAGCATTACGTACAATGGAAAAAGAAAGAATGTGTCTTCCCATTGTAGAGTTCAAAAGGGTGGTAAAGGCAATCCAAAAAGGAGAAAGGCAATCCACTAGAGCTAAAAAAGAAATGATTGAAGCAAATTTGCGTTTAGTGATTTCAATTGCAAAAAAATACGCTAATCGTGGTTTGCAGTTTTTGGACTTAATTCAAGAAGGTAATATTGGCTTAATGAAAGCAGTTGATAAATTTGAATATAGTCGTGGTTTTAAATTCTCTACATATGCAACTTGGTGGATACGTCAAGCAATTACTAGGTCTATTGCAGATCAGGCTAGAACAATTCGTATCCCTGTACATATGATAGAAACTATTAATAAAATTATTCGCACTACTCGTCAAATGATTGGAGAGCTTGGTTATGAGCCAACACCAGCTGAGATTGCTGCCCGCTTATCTATGCCATTAGAAAGAGTTAAGAAAGTAATGAAGATTGCTAAAGAGCCTGTTAGTCTTGAAAATCCTGTTGGTGATGAAGATGGTAGTTATCTTGGGGATTTTATTGAGGATAAAAATGCAGTATTACCAAGTGAAGCGGCTTTTCAGTCTAATTTACGTGAAACCACGACAAGAATTCTTTCAACCTTAACTCCTAGGGAGGAAAGAGTGTTGCGCATGAGATTTGGACAAGAAGCGGTAGTAGCTGGTATCCAAGCTGCAAAGCAAAAAAATGATAGCACAATTACAAGTTATCGTGATCATGGCCATATTATTATGTCTGGTATTGATCCAAAATATGTTATGGCTGAACTCACTGGTAGAGCCTCTGGATGTTCCAAAGGTAAAGGGGGATCAATGCATATGTTTAACAGTACCGGAGATGGGGCAATAAATCAGGGTCAAGTATATGAGGCTTTTAATATGGCGGCTCTATGGAAATTACCAGTAATGTATATTATTGAAAATAATGAATATTCTATGGGCACATCAGTTGAGCGCTCTACAGCAATGACAGATTTATACAGAAAAGGAGAATCTTTTGCAATTTCTGGGATGCAAGTTGATGGCATGGATATTGATGCAGTATATAATGCAACAGTTCAAGCAAGCGAGTATGTACGCTCTGGGAATGGTCCGGCAATTATTGAAGTAAAAACTTATCGTTATCGTGGGCATTCAATGTCAGATCCTGCCACTTATCGTAGCAAAGAAGAAGTAACAGAATATAGAGACAAAGACCCTGTTTTAATGGTAAAAAATATAATATTAGAAAATTCCTATGCAACTGAAGATCAGTTGAAAAAAATTGAGAAAAAAATTAAAGCTCAGATAGCTGAAGTTGCAGAATATGCTACATCAGAGCCATTACCTAGTGAAGATGAGCTCTATACAGATATATATAAATAA

Transcript

ANN25128-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q4UJT1	RNA polymerase sigma factor RpoD OS=Rickettsia felis (strain ATCC VR-1525 / URRWXCal2) OX=315456 GN=rpoD PE=3 SV=1
Q92FZ8	RNA polymerase sigma factor RpoD OS=Rickettsia conorii (strain ATCC VR-613 / Malish 7) OX=272944 GN=rpoD PE=3 SV=1
P33451	RNA polymerase sigma factor RpoD OS=Rickettsia prowazekii (strain Madrid E) OX=272947 GN=rpoD PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0013255 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00140 all species →	Sigma70_r1_2	Sigma-70 factor, region 1.2	Family	Interproscan
PF04546 all species →	Sigma70_ner	Sigma-70, non-essential region	Domain	Interproscan
PF13155 all species →	Toprim_2	Toprim-like	Family	Interproscan
PF04539 all species →	Sigma70_r3	Sigma-70 region 3	Family	Interproscan
PF00676 all species →	E1_dh	Dehydrogenase E1 component	Family	Interproscan
PF04542 all species →	Sigma70_r2	Sigma-70 region 2	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000943 all species →	Domain	RNA polymerase sigma-70	Interproscan
IPR006171 all species →	Domain	TOPRIM domain	Interproscan
IPR029061 all species →	Homologous_superfamily	Thiamin diphosphate-binding fold	Interproscan
IPR009042 all species →	Domain	RNA polymerase sigma-70 region 1.2	Interproscan
IPR007631 all species →	Domain	RNA polymerase sigma factor 70, non-essential domain	Interproscan
IPR036388 all species →	Homologous_superfamily	Winged helix-like DNA-binding domain superfamily	Interproscan
IPR013325 all species →	Homologous_superfamily	RNA polymerase sigma factor, region 2	Interproscan
IPR028630 all species →	Family	RNA polymerase sigma factor RpoD	Interproscan
IPR013324 all species →	Homologous_superfamily	RNA polymerase sigma factor, region 3/4-like	Interproscan
IPR007624 all species →	Domain	RNA polymerase sigma-70 region 3	Interproscan
IPR034151 all species →	Domain	Bacterial DnaG primase, TOPRIM domain	Interproscan
IPR050239 all species →	Family	Sigma-70 factor family, RNA polymerase initiation factors	Interproscan
IPR014284 all species →	Domain	RNA polymerase sigma-70 like domain	Interproscan
IPR001017 all species →	Domain	Dehydrogenase, E1 component	Interproscan
IPR007627 all species →	Domain	RNA polymerase sigma-70 region 2	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR30603 all species →	RNA POLYMERASE SIGMA FACTOR RPO	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003700 all species →	Molecular Function	DNA-binding transcription factor activity	Interproscan
GO:0006352 all species →	Biological Process	DNA-templated transcription initiation	Interproscan
GO:0006355 all species →	Biological Process	regulation of DNA-templated transcription	Interproscan
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0016987 all species →	Molecular Function	sigma factor activity	Interproscan
GO:0016624 all species →	Molecular Function	oxidoreductase activity, acting on the aldehyde or oxo group of donors, disulfide as acceptor	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for ANN25128-RA.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora grisea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora grisea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →