Gene detail

Detailed information of ANN25653-RA in Montipora grisea

Genomic Location: Scaffold_123__1_contigs__length_216336:108622...111664
NR annotation: WP_089370219.1, oxygen-dependent coproporphyrinogen oxidase [Dokdonia pacifica]
Species Montipora grisea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN25653-RA

ATGATTAGAGGCATTATAAACGGACTTAAAACCTACGGGACTTCTTTTGGGCTTGTGACCAAGCTCAAGCTATGGAAGTATTTTGCTATTCCTATGGGAATTAGTTTACTTACCGCTATCATTATAGGGTTTACCGCTTATGGATTGTCTGATAATATGGGGCATTGGATTGAGCAAATATGGCCTTGGGAATGGGGTTTAATCCCAGTTATAGGAATTATCTCAACAGTACTATTATTTCTAATGCAAGCCTATTATGCGGGATTTGGAAATATGGACTACACACTAGAACGTCATTTTACTTATGATAAAAGTGTTCAATTTGTACGTAAACATCGAGGTGAGGCTATCGGCAATGGAATTGTTTTTATGTTGTTTTTATTGATTCCTGTGATAGGAGTTATTTTAGTACTTCCTCTTTCTGTAACTGCAGCCACCAAACAGACCATTGAATTACTTCCTCAAGACCTTCATAAAAATCCAGCAAAATTCCAAGAAGACTTATGGAAACGTCCAGAAGGTGGTGGCGGTCGTACACGTGTTATAGAAAATGGAAATGTGTTTGAAAAAGGAGGCGTCAACATCTCTGAAGTGCATGGGGAATTACCTGCAACGATGCAGCAATATTTTGGTGTAAAAGATGCCAATTTCTTTGCTTGTGGTCTTTCTTTAGTATTACACCCTAAAAGCCCTATGGTACCTACAGTACATGCAAATTGGCGTTACTTTGAAATGTACAATCAAGAAGGTGAAATTGTAGATCAATGGTTTGGAGGCGGTCAGGATTTAACTCCTTATTATCTTTTTGATGAAGATGCGATTCATTTTCATACGGTTTGTAAAAATGCGTGTGATGCTCACGATCCTGAATTTTATCCAAAATATAAAGCACGTTGTGATGAGTATTTTTATAATGCACATCGTAATGAAGGTCGCGGACTCGGAGGCTTATTTTTTGATTATCTGAAAAAGACCGAAGAAAAATCGATGAAAGACTGGTATGATTTTGTCACTACAGTAGGTGATAGTTTCTTAGAAGCCTATATTCCTATTGTAGAGCGTAGAAAAGATACCGCTTTCGCGAAAGCTCATAAAGACTGGCAAGAAGTAAGACGAGGGCGTTATGTAGAATTTAATCTTGTACACGATAAAGGCACTTTATTTGGTCTTAAAACCAACGGCCGTATTGAAAGTATTTTAATGAGTCTTCCTCCTGTGGTACAATGGAAGTATGATTACCATCCCGAAGAAGGAAGTGAAGAAGCAAGATTGGTAGACGTATTAAAAAATCCAAAAGAGTGGGTAAGTACAACTCCAGATCCAGACTTTACAGATGAAGATGCACTCTCTTTTATCAATAAATCAGAAACCTCATTTACTGATGTTGGAGGTATGGAAGGTGTAAAAGAAGAGATTTCGCTAAAAATCATTAAACCTTTACAACACCAAGATTTATATAAAGCATATGGCAAAAAAATAGGAGGAGGTATATTATTATATGGTCCTCCTGGCTGTGGAAAAACACATCTTGCTAAAGCAACCGCTGGTGAAATTAATGCAAGTTTCATTAACGTAGGAATTAATGACATATTAGATATGTGGATAGGTAGTTCTGAACGTAATCTTCATGAGATTTTTGAAGTTGCACGAAAAAACAAGCCTTGTGTTATTTTTATTGATGAAATAGATGCTTTAGGTGCTAATAGAAATGATGTAAGTAAAACGGCCGGACGAACCGTTATTAATCAATTTTTGGCAGAATTAGATGGTCTAGAATCAGATAATGACGGGATTCTTGTCTTAGGAGCTACTAATGCTCCTTGGTACTTAGATCCTGCTTTTAGAAGACCAGGGCGTTTTGATCGTATTATTTTTGTTTCTCCTCCTGATGCAGAGGCTCGTGAGGCTATCTTTAATATACACCTCAAGCAAAAACCAACAAATCCTATCGATTATAAATCATTAGCAAAAGCGTCCAAAGAGTTTTCTGGAGCCGATATTATGGCTGCTATTGATATCGCTGTCGAACACAAATTACAAGCTTCTTTTAAAGATGGAATACCGAAACCTCTTAACACTAAAGATATTTTAAAGGGAATTAAGAAGTCTAAGCCAACAACAAAAGAATGGTTTAGATCTGCAAAAAACTATGCGTTATATGCAAATGATGGAGGGTTATACGATGATATTCTCGATTACTTAAAGTTAAATAAATAG

Transcript

ANN25653-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q7NEK3	Oxygen-dependent coproporphyrinogen-III oxidase OS=Gloeobacter violaceus (strain ATCC 29082 / PCC 7421) OX=251221 GN=hemF PE=3 SV=1
Q7XPL2	Oxygen-dependent coproporphyrinogen-III oxidase, chloroplastic OS=Oryza sativa subsp. japonica OX=39947 GN=CPX PE=2 SV=2
Q9LR75	Coproporphyrinogen-III oxidase 1, chloroplastic OS=Arabidopsis thaliana OX=3702 GN=CPX1 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003795 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01218 all species →	Coprogen_oxidas	Coproporphyrinogen III oxidase	Family	Interproscan
PF00004 all species →	AAA	ATPase family associated with various cellular activities (AAA)	Domain	Interproscan
PF07264 all species →	EI24	Etoposide-induced protein 2.4 (EI24)	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036406 all species →	Homologous_superfamily	Oxygen-dependent coproporphyrinogen III oxidase superfamily	Interproscan
IPR001260 all species →	Family	Coproporphyrinogen III oxidase, aerobic	Interproscan
IPR003959 all species →	Domain	ATPase, AAA-type, core	Interproscan
IPR003960 all species →	Conserved_site	ATPase, AAA-type, conserved site	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR003593 all species →	Domain	AAA+ ATPase domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10755 all species →	COPROPORPHYRINOGEN III OXIDASE, MITOCHONDRIAL	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004109 all species →	Molecular Function	coproporphyrinogen oxidase activity	Interproscan
GO:0006779 all species →	Biological Process	porphyrin-containing compound biosynthetic process	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0006782 all species →	Biological Process	protoporphyrinogen IX biosynthetic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for ANN25653-RA.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora grisea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora grisea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →