Gene detail

Detailed information of ANN27178-RA in Montipora grisea

Genomic Location: Scaffold_277__1_contigs__length_125908:58531...60665
NR annotation: MCG8594652.1, extracellular solute-binding protein [Kiloniellales bacterium]
Species Montipora grisea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN27178-RA

ATGAAAGCGCCTAATTTGCGGCTAGAGTCCTGGAGATCCACGATTCGTCCGAGTCTCGATGCCGCCAAGCCTCCCCGCCACCGTCCGTTCCGCCGCGCTTTCAGCCGGCCTTTCGCTGATGCTCGCCGCGCTGCTTTTGCCGGCACCGGCCGGCGCCCAGAACGCGCCGCCGGCGGTTCCGCTGGTCGAGGTCGAGGTCGAAGGCCAAGAACTGGCGCCGCTCTCCTCGACGGTCTACCAGGCGCACGGCATCGCCATGCACGGCCAGCCCAAGTACGGGCCGGACTTTCCGCACTTCGACTACGTCAATCCCGACGCGCCCAAGGGCGGCACCCTGCGCACCGGCGCCCAGGGCACCTTCGATTCTTTCACCCCTGGATCTCCAAGGGCACGCCCGCCTCGCCCGGTGGCGACACCCTGCTGACCCACGCCGCCGATGAGGCCTTCACCGAGTACTGCCTGATCTGCGAGACCGTCGAGTGGCCGGAAGACCGCAGTTGGGTGACCTTCCATATCCGGCCCGAGGCGCGCTGGCACGACGGCCAGCCGATCACGCCGGAAGACGTGATCTTCTCGCTCGACATCCTCAAGGAGAAGGGCCGACCGATCTATCGCTTCTACTACGGCTCGATCACCGGCGCCGAGAAGGTCGGGGAGCGCTCGGTCAAGTTCGTCTTCGGCGAGGAGGAGAACCGGGAGCTGCCGCTGATCGCCGGCCAACTGCCGATCCTGCCCAAGCACTATTGGGAGGAGCGTGAGTTCGACAAGACCACGCTCGAGCCGCCGCTGACCTCCGGTCCCTACCGGATCGTCGAGTGGGAGCCGGGCCGCTTCGTGGTGCGCGAGTTGGTCGAGGACTATTGGGCCAGGGATCTGCCGGTCAATCGCGGGAAAAACAACTTCAAGCGCATGCGCACCCAGTACTACCGCGACGCCACGGTGATCCGGCAGGCCCTGAAGGCCGGCACACTCGACTATCGCACCGAGAACCAGGCCAAGGCCTGGGCCCTGGAGTATGACATCCCGGCGCCGGCCGACCGGCATGCAGGCCTTCATCTTCAACACCCGGCGCGAGATCTTCCAGGACCGCAAGGTGCGCGAGGCCTTGGCCTACGCCTTCGATTTCGAGTGGACCAACCCGACGCTGTTCTTCGACCAGTACACCCGCAACGACAGCTACTTCGAGAATTCCGAACTGGCCTCGACCGGCAAGCCGAAGGGCGTGAGCTGGAGATCCTGGCGCCCTATCGCGGCCGGGTGCCCGACGAGGTTTTCGAGGCGACCTACTCGGTCCCGGTCACCGACGGCAGCGGCTGGCCGCGCAACAACCTGGCGACCGCCCTGGACATCCTCGAGTCCGCGGGCTGGGCGATCGACGACGCCGGCACCCTGCGCAACGGCGACAGCGGCGAGGCCTTCGCCTTCGAAATGCTGCTGGTCAGCCCGGACTTCCAGCGCATCGTCCTGCCCATGGCGCGCAACCTGAAGCGCATCGGCATCGAGATGAAGGTCCGCCTGGTCGACTCCTCGCAGTACATCAACCGCTACCGCTCCAAGGACTTCGACATGCTCTCGGCCGGCTGGGGCCAGTCCGACTCGCCGGGCAACGAGCAGCGCGACTACTGGTCGAGCGCCGCCGCCGAGGCGCCGGGCTCGCGCAATCTCGCCGGCATCAAGGACCCGGTCATCGACGAGCTGATCGAGCTGGTGATCCAGGCGCCCTCGCGCGAGGAGCTGATCATCCGCACCCGCGCCCCTCGACCGCGTGCTGCTCTGGGGCTACTACGTGATCCCGGCCTGGCACCTGCAGAGCGACCGGATCCTCTACTGGAACAAGTTCGACTTCCCACCCGAGCCGCCGAAGAACGGCACCAGCATCGACCTTTGGTGGTTCGACGAGGCCAAGGCCAACGCCCTGGCCGCCCAGCAGCCCAACACCGGCACCGCGACCGACGGCAACGGCCAGCAGGTCGCCAGCTTCGACTCGCGCAAGCTGCTCGGCCTTTCTTCATCGTCCTGATCGCCGCCGCCTGGTTCGCCCTCAAGGTCGGCGGCCGGCGGCGTGACGATCCGACCGCGGTGATCGAGTCATGA

Transcript

ANN27178-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P55691	Uncharacterized protein y4wM OS=Sinorhizobium fredii (strain NBRC 101917 / NGR234) OX=394 GN=NGR_a00920 PE=3 SV=1
A9CKL4	Probable peptide-binding protein YejA OS=Agrobacterium fabrum (strain C58 / ATCC 33970) OX=176299 GN=yejA PE=3 SV=1
Q8YC41	Putative binding protein BMEII0691 OS=Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M) OX=224914 GN=BMEII0691 PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0018185 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00496 all species →	SBP_bac_5	Bacterial extracellular solute-binding proteins, family 5 Middle	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000914 all species →	Domain	Solute-binding protein family 5 domain	Interproscan
IPR039424 all species →	Family	Solute-binding protein family 5	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR30290 all species →	PERIPLASMIC BINDING COMPONENT OF ABC TRANSPORTER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0015833 all species →	Biological Process	peptide transport	Interproscan
GO:0030288 all species →	Cellular Component	outer membrane-bounded periplasmic space	Interproscan
GO:0042884 all species →	Biological Process	microcin transport	Interproscan
GO:1904680 all species →	Molecular Function	peptide transmembrane transporter activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for ANN27178-RA.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora grisea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora grisea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →