Gene detail

Detailed information of ANN28342-RA in Montipora grisea

Genomic Location: Scaffold_172__1_contigs__length_171470:90504...92567
NR annotation: MSR58945.1, response regulator [Planctomycetaceae bacterium]
Species Montipora grisea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN28342-RA

ATGCGGGCCGACGTCGAGGAGCACGTGGTGTGGCTGATCGAGATTCAATCGATCTCCGAGGCGAGCGAGGCCGACGACCCACAGTGGCCGCTGCTGCGAGATCGCCTAGAGCTACTCCGGGAAGGCGTGAGCTCGCATCCCGACAGCCTAGGCGACGGCTCCGGGCTGGTCACGGTGGCAACCACAATCGATGCAGCCCTGGCGGCGTTACCCGGCGATTCGCAGCCTACCACTGCTCAAGTCGACGCACTTCACAGCCATCTCAACAGCTTGGTTCGTCGGATACGCGGCCGCACAGGTGGGCTGTCGGCAGTGCTCAGCGAATATTGGAACTCGCTGATCGCACTCGCCCTGAGTGCGCTGTTGCTGTTGGCGGTTTGTGGCGCATTGGTCCGGCGATTGTCCAACCAACGCCATGCGCTCGCCGAAGCCAACCGCCACCTCAGCGCCGCCAAGCTCTCGGCCGAGGCCGCCAATCGTTCGAAGGGCGAGTTTCTTGCCGACGTCAGCCATGAAATCCGCACACCCATGAATGCCATTTTGGGGATGACCCACCTCGTGCTCGAAAGTCCGCTCGCGTCGGAGCAACGGAAACATCTACAGGTTGTACGGGCGTCTGCCGAGGGGCTGCTTGGGCTTGTCAACGGACTTCTCGACCTCTCAAAAATTGATGCCGGCAGGCTCGAGATCGAGTCGGCCGCGTTTGACCTGCGAGCGTGTGTCGGCGGTGTCCTGCAGGCTCTGGCCATGGGTGCCGCCGAAAAAGGTCTCGAGCTCGTGGGCGAGGTGGCGCCACAGGTTCCCCAACAGATCTTCGCCGACGAGGCACGATTGCGGCAAACACTGCTTAACCTCGTGGGAAATGCCATCAAATTTACGGACAAGGGCGAGGTGGTTGTACGCATTGAAGTTGTCGAAACTCCCGCCAATGATACGCCGCAAACCTCGAGCGACATGAGCCCGGAGTTTGAGCTGGTGTTCTCGGTGCAAGACACGGGCATTGGCATCGCCGCAGACAAGCTCGAGGAGATTTTTGTGGCCTTCAAACAGGCCGACGTGACGACCTCACGGCGGTTTGGTGGCACCGGCCTCGGGTTACCCATTTCCAAACGCCTCGTGGGCCTGATGGGCGGGAGCTTGACGTGCACGAGCCAACCCGGCCACGGATCGAACTTTACATTTACGCTGCCAACCCGGGCAGTTGGTCCGTGGCAAGACCCTATGTATATGCAGGAGAAGGCGGCACTGAGCGGGCGTCGGCTCGTGGTTATCGAACCCAACCCCATTGCAGCCAATGCCATCACCCGGGCGGCCGAGAGTTGGGGAATGGAGGTCGAGGCCGTTGCCGAACGCGAGGACCTTGCCACGCGACTGCGTGGCGATGGGCAAGCATCCGCCCTGATTGTGCTCAATGGCGATGACCGGCACGACCATTTTGACTGGTTTCAAACCCAGCTCTCACACGAGCCAACACTCGCCGCGCTTACGCTGGTGATTGTGCCCGTAACCGTGCCGCGAGAGCGCTTCCAACGGTTCTCGGAACTTGGCCTATGCTACCTCACCAAGCCGGTGCTCGACCGTGACTTGCGAACCTCCCTCGCCGGCGTGGCGACAAACGGTGAGCTCTCGCGCGAGCCATCGGGCCCGGCTCCCGGTCCCCAAATCGAGCACCCGGGCCTGAAGATCCTCGTGGTGGACGACAGTGCGACCAACCGAATGTTGGCAGTTGGGCTGCTGGGCAGGCACGCCGACGTCAGTGTTGCATACGACGGGCGTCAAGCACTCGAGATGATCGAGCAGCAGGCCTTCGACCTGGTGTTGATGGATGTGCACATGCCGGTGATGGACGGCCTAGAGGCGACAAAGACCCTGCGCCGGCTCGAGGGGACAGGGCGACAGCGCCTGCCGGTTGTGGCCCTGACCGCAGGTGCAACCTCGGAGGAGCGCTCGTCGTGCCTCGCGGCCGGGATGGACGAGTTTGTCGACAAACCGATTCGCCCACATGTGCTCTATGCCAAGATCAACACGATCATGCGGGCGCACAGCAGCCGTCCACCTGCCTGA

Transcript

ANN28342-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q54YZ9	Hybrid signal transduction histidine kinase J OS=Dictyostelium discoideum OX=44689 GN=dhkJ PE=3 SV=2
Q9F8D7	Sensor histidine kinase GacS OS=Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0) OX=1124983 GN=gacS PE=3 SV=1
Q5A599	Histidine protein kinase NIK1 OS=Candida albicans (strain SC5314 / ATCC MYA-2876) OX=237561 GN=NIK1 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0007005 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02518 all species →	HATPase_c	Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase	Domain	Interproscan
PF00512 all species →	HisKA	His Kinase A (phospho-acceptor) domain	Domain	Interproscan
PF00072 all species →	Response_reg	Response regulator receiver domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036890 all species →	Homologous_superfamily	Histidine kinase/HSP90-like ATPase superfamily	Interproscan
IPR005467 all species →	Domain	Histidine kinase domain	Interproscan
IPR003661 all species →	Domain	Signal transduction histidine kinase, dimerisation/phosphoacceptor domain	Interproscan
IPR003594 all species →	Domain	Histidine kinase/HSP90-like ATPase	Interproscan
IPR001789 all species →	Domain	Signal transduction response regulator, receiver domain	Interproscan
IPR004358 all species →	Domain	Signal transduction histidine kinase-related protein, C-terminal	Interproscan
IPR011006 all species →	Homologous_superfamily	CheY-like superfamily	Interproscan
IPR036097 all species →	Homologous_superfamily	Signal transduction histidine kinase, dimerisation/phosphoacceptor domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45339 all species →	HYBRID SIGNAL TRANSDUCTION HISTIDINE KINASE J	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000155 all species →	Molecular Function	phosphorelay sensor kinase activity	Interproscan
GO:0007165 all species →	Biological Process	signal transduction	Interproscan
GO:0000160 all species →	Biological Process	phosphorelay signal transduction system	Interproscan
GO:0016310 all species →	Biological Process	phosphorylation	Interproscan
GO:0016772 all species →	Molecular Function	transferase activity, transferring phosphorus-containing groups	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for ANN28342-RA.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora grisea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora grisea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →