Gene detail

Detailed information of ANN28652-RA in Montipora grisea

Genomic Location: Scaffold_4068__1_contigs__length_33470:21532...25004
NR annotation: MBL4804174.1, dihydroxy-acid dehydratase [Alphaproteobacteria bacterium]
Species Montipora grisea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN28652-RA

ATGTTTGATGAAAAACGCGCACACCCAAACGGATGGGACAAAGACAAACTTGTTTCCCGTTATGTTACCGAAGGACCGGAAAGCGCACCGCACCGCGCTTATTACTACGCAATGGGCATTACGGAGGAAGAAATTCATCAGCCGCTTGTCGGGGTGGCGACATGTTGGAATGAAGCAGCGCCATGTAATATTGCGCTTTCTCGTCAGGCACAGGCGGTAAAGGTCGGTGTCAAAGAAGCCAAGGGTACACCCCGCGAGTTTACAACAATTACAGTGACTGACGGTATTGCGATGGGGCATGAGGGGATGCGTTCTTCGCTTGCGTCACGCGAGGTTATTACGGATTCCGTTGAATTGACGATGCGTGGCCATTGTTATGATGCGCTTGTCGGTCTTGCGGGCTGTGACAAGTCCTTGCCTGCGATGATGATGGCGATGGTTCGCCTGAATGTGCCATCAATCTTCATGTATGGCGGTACGATATTGCCCGGTAAGTTCCGTGGTCAAGATGTTGATATCGTTAATGTGTTTGAAGGCGTTGGTAAACACTCTGCCGGGGAGTTCAGTGATGATGACTTGAAAGAACTGGAATGTGTGGCTTGTCCGTCGGCAGGTGCTTGCGGTGGTCAGTTTACGGCTAACACTATGGCGTGCGTTTCTGAAGCGATGGGCTTGGCGTTACCACACTCTGCAGGAGCACCTGCGCCTTATGAATCCCGCGACGAATATGCGAAGGCTTCGGGCGAAGCTGTGATGAATTTGATCAAGAATGGTGGTCCGTATCCGCGTGATGTCGTGACCCGTAAAAGCCTCGAAAACGCGGCTGCAATTGTTGCTGCGACTGGTGGTTCGACCAATGCAGCTCTGCATTTGCCCGCAATTGCACATGAAGCGGGAATTGAATTCAATCTGTTCGATGTTGCGGAGATATTTAAAAAGACGCCATTGATTGCCAATTTGCGCCCGGGCGGAAAATATGTCGCCAAAGATTTGCATGATATCGGCGGTGTCGGTGTTGTGATCAAGGAGCTTTTGGATAACGGATATCTACATGGTGATTGTATTACCGTTACCGGTAAAACACTGGCGGAGAACTACGCCGATGTGACTTTGCCGGAAGGGCAGGATGTGGTGTTCCCGTGTTCTAATCCTATTCACCCGACAGGCGGTGTTGTTGGTTTGAAAGGTAATCTGGCGCCAGAGGGCGCAATTGTGAAGATTGCGGGTCTGGAAGAGCTGCAGTTTGAAGGACCTGCGCGCGTGTTTGAAGGTGAGCAGGCCGCGTTCGACGCCGTTCAGGCTCGTGAATATGAAGACGGTGATGTTATCGTTATTCGTCAGGAAGGGGGCAAAGGTTGCTCTGATTACCGATGGTCGTTTTCGGGCGGTACACGTGGTTTTTGTATCGGGCACGTTGGCCCGGAAGCCGCTGTCGGCGGACCGATCGGTTTGCTGAAGGATGGTGATGTCATCAGCATTGATGCAGTGAAAGGCACGCTTGAGGTCGCACTTAGCGAGGACGAGTTGGCTGAACGCAAGAAATCATGGAAGCCACGTAAGACGAATTACAATAGCGGTGCTTTGCAGAAATATGCGGCTCTTGTCGGTCCTGCCCGTGATGGTGCGGTTACGCATCCGGACAGATTGGCGACTTATGACGGTGTTTCAGCTGAGGCTTTATTGACCCAAAAAGCAGGTGTTGACGGTGCTCTGAAGCGCTTGTTCACAGTATTAGTTGAGTTTTATACGGCTCGTGAATTTGAGCCTGTGTGGGTTGGTTCAAACAGGGTCAAGTCATCGGGTAAAGATATGTTCGAGTTGGTTGAGGAAAGCTGGCTTCACGGTCTTAATCCATACGCCTATCATATGGAGGCGTTAAGCGCCCGTATGAATGAGCGCGGGCAGGATAATCTGGCCTATGTAGAGTTGTTGCTAACTGATGCTTATTTGAGGCTTGGTCATGATTTAAGCGGGATACGTGCCGTGCCTGCGCTTCGCGTGCGTTTGGGGATTGACGCCCCGCAAACGGAAGACGAGCTACTTTATGATGATCAACTGGCCGCGGCTGTCATCAAGTTTCAGCGCGACAATGATCTTACCGATGACGGGTTGGTTGGGAAGCAAACGCTCGAAATTCTGAACAAGTCTCGTAAGGATCGTATCAACCAGCTTATCGCAAACCTTGAGCGGTTACGTTGGGTTGAAGACGAGAAGCCTGAAGATTTTGTGGTTGTTAATGTGCCTTCAGCAACGTTGTGGGCGATTGAAGATAATCGTGTTGCATTCGAAATGCCGGAAGACCCTGAGTATTTGATGCAAAAGGGGATGCAACTCATTAGTGGACGCGGAGAAGGTGCAATGACCCTTGACCCCGCCTCAATGGACTGGACGGAGGTGAGTGAGGAGGAGTTGACAGCCTTACGCATGGTGCAGGTACCTGGGCGTAACAACCCTCTTGGGCTTTACCGGGTGCATATGCCGAACAGCTACAATATCTATCTGCATGATACGAATGAGAAATATCTGTTTGACCGTGCGTCTCGCGCTGTGTCTTCGGGGTGTATCCGCATGAAAGATCCGGAGCGTATGGCTCATTTTATAATGAAGCAGCGTCCGGGCTGGTCTCAGGACAGACATGACAGAATTCTGGCCTCGGCCGAGAAGACGGATCTCTATATTCGTGACCCCATTCCTGTATATATTCTGTATTACACAGCGTGGCTCGATTCATCCGACGAATCATTTACGGACAAGATTTATACGATTTTGACCGAAATTTGA

Transcript

ANN28652-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A7HXI4	Dihydroxy-acid dehydratase OS=Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966) OX=402881 GN=ilvD PE=3 SV=1
Q89KY5	Dihydroxy-acid dehydratase 2 OS=Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110) OX=224911 GN=ilvD2 PE=3 SV=1
A8LKN5	Dihydroxy-acid dehydratase OS=Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12) OX=398580 GN=ilvD PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002795 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00920 all species →	ILVD_EDD	Dehydratase family	Family	Interproscan
PF20142 all species →	Scaffold	Scaffold domain	Domain	Interproscan
PF01471 all species →	PG_binding_1	Putative peptidoglycan binding domain	Domain	Interproscan
PF03734 all species →	YkuD	L,D-transpeptidase catalytic domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR020558 all species →	Conserved_site	Dihydroxy-acid/6-phosphogluconate dehydratase, conserved site	Interproscan
IPR005490 all species →	Domain	L,D-transpeptidase catalytic domain	Interproscan
IPR000581 all species →	Family	Dihydroxy-acid/6-phosphogluconate dehydratase	Interproscan
IPR045380 all species →	Domain	L,D-transpeptidase, scaffold domain	Interproscan
IPR042096 all species →	Homologous_superfamily	Dihydroxy-acid dehydratase, C-terminal	Interproscan
IPR038063 all species →	Homologous_superfamily	L,D-transpeptidase catalytic domain-like	Interproscan
IPR050165 all species →	Family	Dihydroxy-acid dehydratase IlvD/Edd	Interproscan
IPR036366 all species →	Homologous_superfamily	PGBD superfamily	Interproscan
IPR002477 all species →	Domain	Peptidoglycan binding-like	Interproscan
IPR037237 all species →	Homologous_superfamily	IlvD/EDD, N-terminal domain	Interproscan
IPR036365 all species →	Homologous_superfamily	PGBD-like superfamily	Interproscan
IPR004404 all species →	Family	Dihydroxy-acid dehydratase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR21000 all species →	DIHYDROXY-ACID DEHYDRATASE DAD	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003824 all species →	Molecular Function	catalytic activity	Interproscan
GO:0016740 all species →	Molecular Function	transferase activity	Interproscan
GO:0016836 all species →	Molecular Function	hydro-lyase activity	Interproscan
GO:0004160 all species →	Molecular Function	dihydroxy-acid dehydratase activity	Interproscan
GO:0009082 all species →	Biological Process	branched-chain amino acid biosynthetic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for ANN28652-RA.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora grisea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora grisea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →