Gene detail

Detailed information of ANN28843-RA in Montipora grisea

Genomic Location: Scaffold_158__1_contigs__length_178343:12517...14598
NR annotation: MCH1550165.1, carboxy terminal-processing peptidase [Pseudomonadales bacterium]
Species Montipora grisea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN28843-RA

ATGCGTCGCATCTCTTTCTTCCTCTTAGTCTTGTCTGCCGGGCTAACTCCCCCTTTAACTGCCAGCCAGCTCGATGAAACGACTTTTGACTTTGAAGAAATCGAGCCGTTGCCAGTGCACGAGAGAACCAACAAGAACATCGTGGATCAAGTCCGGGCACATCATCTCCGGGACAAGCCGCTAGACGACAATGCTTCGAGTCGAATCTTTGACAAATATCTCGAAGTTCTGGACTTCAACAGAAGAGTCTTTTACCAAACCGACATTGAGGAATTTGAGAAGTATCGCTTCGAACTCGACGATGCGCTCAAGAACGGCGATCTCGAGCCTGCTTTCGATATTTTTAATCGTTCGCAGATTCGGCGTATCCAACGTCTAAAGTACGTACTACAACGACTCGAAGACGGCATCGGCACGTTCGATTTAAATACGGATGAACGCATACCGTTAGATCCGGAGCACGAACGCTGGCCTGCCAATGCGCAACACGCTGCGAAACTTTGGGACATATCACTCACCGATCAGATTATCCGCTACCAGCTAAACGGCAAGAAGGACAATGAAATTGCGGATACGCTTCGAAAGAGCTATGACCGGCTGTTGAAGAATGCCCTGAAGACGAACAACGAAGACGTTTTTCGTCTCTACATGAATGCGTTCAGCACAACATACGACCCGCACACAAACTACTTCCCACCGATCGATTCGGATAATTTCCACATACCAATGTCGTTGAAATTGGAGGGAATCGGCGCTGAACTTCGGACCGTAGACGATTACGTCCAGGTTGTGCGGCTTCTCCCAGGCGGTCCCGCCGCTCTCGATGGCCAACTCCACGCGACAGATCGTATCGTTGGCGTTGGGCTGGCGGTGGACAAACCTATTACCAATGTGATCGGCTGGCGTCTGGATGACGTCGTCGACATGATTCGAGGACCCAAAGGCACCGTCGTCGTGCTTGAGATCCTCCGCGACGATGAGTCGACCAAAACCATAGCCATCACTCGAGATACGGTTGATATAGAGGAAGGAGCCGCAAAGAAGGAAATTCTATCGCTTAATTACCAAGGACACGAGCGCAAGATCGGCGTTATTACCATACCAGCCTTTTACTTTGATTTCCTAGCTCAGCAACGAAAGCTAGCTGATTATCGGCGCGTCTCTAAGGACGTGAAAAACCTCATTAACGAATTGAAAGCAGATAACGTCGATGGGTTGGTTATCGATTTACGAAACAATGGCGGTGGGTCGTTGGACGAAGCAAATGTAGTAACGGGATTTTTTATTGAAACCGGACCGATTGTCCAAACAAAGTTCCATAGGCGCCCGCCGCGGATAACTCAGGACCGCAATCCAGCGATCGAATGGGAAGGACCTCTGGCGGTTCTTGTGAACCGGCGGTCAGCGTCGGCGAGCGAAATTTTCGCTAGTGCAATCCAAGATCATGGACGCGGCATCATCTTAGGCTCGCAGACATTTGGCAAAGGGACAGTTCAAACGATAATACCTTTGAATCGAGGTCAACTGAAAGTGACTCAAGGAAAGTTCTATCGAATCTCTGGAAAAAGCACTCAACTTGCCGGCGTCACGCCCGACATCGAGTTTCCTGATTTATTAGGAGGCAAGTACATTGGCGAACATTCGTATAAAGATCCGCTACCAGAGGACGAAGAGAAACCAGCTAACTACTCGCCAGTCAGCGATATTGAACTCATTAAAGATCAGCTCGTCGATAGACATGCCGAGCGCATTAAGGAGAATCCCTACTTCGACTATTTCAAAGCTATTGAGCAACGACGTGTAGAGAACTATGCTCGCACGCACCGGTCGGTAAACAAGGAATTGCGTGCCCAAGCGCGTACCGAAGAAGACGATTGGCGCTTAACAACAATCAACGATCTACGTGAGGCGACTGGCAAGGAGCCGGTAGCCACGGTTGATGAGCTGGATGAACGTATCGGTGTGCCTGAGACTGACGCGATGCTTGAAGAAGCTGGCTTCATTTTACTTGACTACATGAATCTTGGTGCGCCGCTGGCTATGGCCGATGAATTGACGTCTGCTCCAATTGTACCTCAATGA

Transcript

ANN28843-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P43669	Tail-specific protease OS=Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720) OX=99287 GN=prc PE=3 SV=2
P23865	Tail-specific protease OS=Escherichia coli (strain K12) OX=83333 GN=prc PE=1 SV=2
P45306	Tail-specific protease OS=Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd) OX=71421 GN=prc PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0015113 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00595 all species →	PDZ	PDZ domain	Domain	Interproscan
PF17804 all species →	TSP_NTD	Tail specific protease N-terminal domain	Domain	Interproscan
PF03572 all species →	Peptidase_S41	Peptidase family S41	Family	Interproscan
PF11818 all species →	DUF3340	C-terminal domain of tail specific protease (DUF3340)	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036034 all species →	Homologous_superfamily	PDZ superfamily	Interproscan
IPR001478 all species →	Domain	PDZ domain	Interproscan
IPR004447 all species →	Family	C-terminal-processing peptidase S41A	Interproscan
IPR029045 all species →	Homologous_superfamily	ClpP/crotonase-like domain superfamily	Interproscan
IPR005151 all species →	Domain	Tail specific protease	Interproscan
IPR040573 all species →	Domain	Tail specific protease, N-terminal domain	Interproscan
IPR020992 all species →	Domain	Tail specific protease, C-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR32060 all species →	TAIL-SPECIFIC PROTEASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0006508 all species →	Biological Process	proteolysis	Interproscan
GO:0008236 all species →	Molecular Function	serine-type peptidase activity	Interproscan
GO:0004175 all species →	Molecular Function	endopeptidase activity	Interproscan
GO:0007165 all species →	Biological Process	signal transduction	Interproscan
GO:0030288 all species →	Cellular Component	outer membrane-bounded periplasmic space	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K03797	E3.4.21.102, prc, ctpA; carboxyl-terminal processing protease	EC:3.4.21.102	Peptidases and inhibitors	ko01002	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora grisea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora grisea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →