Gene detail

Detailed information of ANN30544-RA in Montipora grisea

Genomic Location: Scaffold_6788__1_contigs__length_26262:11386...14002
NR annotation: WP_061094373.1, MULTISPECIES: CTP synthase [Alteromonas]
Species Montipora grisea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN30544-RA

ATGCTGATTATTACTGGCCCCAACATGGGCGGTAAATCAACTTATATGCGCCAAACCGCGCTCATTGCATTACTGGCCTGTATCGGCAGTTTTGTGCCTGCAGAAAATGCACATATTGGAAAACTTGATCGTATATTTACCCGTATTGGTGCATCAGACGATTTAGCTTCAGGTCGCTCTACCTTTATGGTTGAGATGACAGAAACGGCGAACATTCTAAACAATGCCACAGAAAACTCTTTGGTATTAATGGATGAAATAGGCCGTGGCACCAGTACCTATGATGGATTGTCACTGGCGTGGGCATGCGCAAGTTATTTAGCAAAGCAGCTGAATGCTTATACGCTTTTTGCCACGCATTACTTTGAACTAACTGAACTTCCAGAAACCCAAAGTGGCGTAGTGAATGTGCACTTAGATGCGATGGAGTTTGAAGATACCATACGCTTCATGCATACCGTATCAGAAGGCGCAGCGAGCAAAAGCTTTGGTTTACAGGTTGCCCAACTTGCAGGCGTACCTAAGGCGGTAATAAAAGCGGCGCAACAAAAACTTGCGGTGTTGGAATCATCACACCTTATGACCAGCACGGAAGATGGATCAGAGAAAGCCAACGATGAGGCTTTTGTAGCGAAGCGCTCGGTAAAAGATGTAAATAAAACAAGCGCATCAGGTAAAGCTACATCAAATACCAAAGGCCAAGCTGAAATGCTGTTCCCTGATAAGCCCCACCGGTATTGCTGCAGCATCGTTGGCCGCAATTCTGGAAGCTCGCGGTCTCACCGTAACCATGTTAAAACTCGACCTTACATCAATGTCGACCCGGGCACTATGAGCCCTATCCAGCATGGTGAAGTATTTGTTACCGATGACGGCGCTGAGACCGACCTTGATCTTGGTCACTATGAGCGTTTTATTCGCACCCGCATGACCAAGCGCAACAACTTCACTACCGGCCGTGTATATGAAGAAGTGTTAAAGCGCGAGCGTCGCGGTGATTATCTTGGTGCAACTATTCAGGTTATCCCTCATATCACCAATGAAATTAAGCGCCGCGTAATTGAAGGTGCTGAAGGTCACGATGTAGCTATTGTTGAAGTGGGCGGAACCGTAGGCGACATCGAGTCACAACCTTTCTTAGAAGCTATTCGTCAGCTAGGTACCGAAGTAGGCCGTGAACGCGCTATGTTCATGCACCTAACGCTAGTACCTTATATGCCAGCATCAGGTGAAGTAAAAACTAAGCCTACGCAGCACTCGGTAAAAGAGCTTCGCTCAATTGGTATTCAACCAGACATTCTCGTTTGTCGTTCAGTAGGTGCATTGCCGGCTAGTGAGCGCTCGAAAATCGCTCTATTCACAAACGTTGCTGACAAAGCCGTTATTTCTTTGAAAGACGTAGACAGCATTTACCGCATCCCTGCTGCACTTAAAGCACAAGGCATGGATCAGCTAGTTGTGGACCGCTTCGGTCTTGAGTGTGAAGAAGCCGACTTATCTGAGTGGGAACAAGTACTTTACGCTGAGTCTAACCCTACTGCTGAAGTTAATATTGGTATGGTAGGCAAGTATGTTGAGCTACCTGACGCTTATAAGTCTGTAAACGAAGCGCTTAAGCACGCTGGCCTTAAAAATCGCCTCACCGTGAATATTCACCACATCGACTCGCAAGACGTGGAAAGCAAAGGTACCCAAATTCTAGAAAAACTAGATGCTATCTTGGTACCTGGCGGCTTTGGCGAACGCGGCATAGAAGGTAAAATTTCTGCTGCTCGTTATGCCCGTGAAAACAAAGTCCCTTACCTTGGCATTTGCTTAGGTATGCAGGTAGCACTTATCGAGTACGCGCGCAATGTTGCAGGTATGGAAAATGCGAACAGCACAGAGTTCGACCCTGAAACGCCTTATCCTGTTGTGGGCCTAATCACTGAGTGGTTAGACGCAGCTGGTACAACTGAAACTCGCACTGAAAACTCAGATCTTGGTGGTACTATGCGCTTAGGTAGTCAGCTATGTCACCTTATTGAAGGTACAAAAGTTCATGAGATGTATGGTAATGCCGAAATTTATGAGCGTCACCGTCACCGTTATGAAGTGAACAATAACCTGCGCGACCAAATTGAAGCTGCGGGATTGAAAGTAAGTGGTTTGTCCACTGACAAGCGACTTGTAGAAGTGGTGGAAATCCCTGATCATCCTTGGTTCATTGCGGGCCAATTCCACCCTGAGTTCACATCAACTCCTCGGGATGGACACCCATTATTCACTGGTTTCGTTGCTGCGGCAGGAAAATACCAGAAAGAAAATCACTAA

Transcript

ANN30544-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
B4RVU4	CTP synthase OS=Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype) OX=1774373 GN=pyrG PE=3 SV=1
Q15QR7	CTP synthase OS=Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087) OX=3042615 GN=pyrG PE=3 SV=1
A0KGH2	CTP synthase OS=Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049) OX=380703 GN=pyrG PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002829 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00117 all species →	GATase	Glutamine amidotransferase class-I	Domain	Interproscan
PF00488 all species →	MutS_V	MutS domain V	Domain	Interproscan
PF06418 all species →	CTP_synth_N	CTP synthase N-terminus	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR004468 all species →	Family	CTP synthase	Interproscan
IPR000432 all species →	Domain	DNA mismatch repair protein MutS, C-terminal	Interproscan
IPR029062 all species →	Homologous_superfamily	Class I glutamine amidotransferase-like	Interproscan
IPR017926 all species →	Domain	Glutamine amidotransferase	Interproscan
IPR033828 all species →	Domain	CTP synthase GATase domain	Interproscan
IPR017456 all species →	Domain	CTP synthase, N-terminal	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11550 all species →	CTP SYNTHASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003883 all species →	Molecular Function	CTP synthase activity	Interproscan
GO:0006221 all species →	Biological Process	pyrimidine nucleotide biosynthetic process	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0006298 all species →	Biological Process	mismatch repair	Interproscan
GO:0030983 all species →	Molecular Function	mismatched DNA binding	Interproscan
GO:0006241 all species →	Biological Process	CTP biosynthetic process	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0019856 all species →	Biological Process	pyrimidine nucleobase biosynthetic process	Interproscan
GO:0042802 all species →	Molecular Function	identical protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for ANN30544-RA.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora grisea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora grisea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →