Gene detail

Detailed information of ANN30829-RA in Montipora grisea

Genomic Location: Scaffold_1436__1_contigs__length_55179:14843...18123
NR annotation: MAD65324.1, AMP-binding protein [Haliea sp.]
Species Montipora grisea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN30829-RA

ATGGAGAACGCTATGACCAATTTTAGAGACATTGAAGGCCTGTTGGACGAGCGTACCCTCCGCTTCCTAGGGGTAGGGGGCCACGAGCATCGTATGCTGATTGGCGAGAATTGGATTGATGCTCAGGATGGCGCTCGGATTGACATCATTAATCCAGCTACAGAACAGAAGCTGGGCAGCATTCCGGCCGCGTCAGCGGATGACGTAAATACTGCCGTCAATACCGCGAGAGCCGCATTCGATAGTGGCTCTTGGGCGCGCGCGCGACCGGCTGACCGCGAGCGACTGTTACTTAAACTGGCGGATTTAATGGAGCGCGACGCCTTAGTGCTAGCGCAACTTGAATCTATTGATAACGGCAAGTCTGCCCAGATTGCAGAATCGGTGGACGTCACTCTGGCGATTGGCTTTTTTCGTTATATGGCGGGTTGGGCAACCAAAATTGAAGGTGGCACCCACACTGTCTCTGCACTCGCCGCGCCACGCGAAGCGGAGTTTTCTGCTTTTACCTACCGCGAGCCTGTCGGCGTTGTTGCAGCAATTGTTCCGTGGAATTTTCCATTGTTGATTACAAGCTGGAAGCTTGGCCCAGCACTCGCGGCCGGTTGCACTGTGGTGCTTAAGCCCGCAGAGCAAACTTCACTTTCTGCGCTGTATTTGGGTAGATTGATTCAGGAAGCGGGTTTCCCCGCAGGTGTTGTCAATATCGTCACCGGTGATGGTTCCAATACTGGCGAAGCACTGATCCGTCATCCCGGTATCAACAAAATCAGCTTCACAGGCTCAACAAAAGTCGGGCAGTTGATCGGTCGTGCTGCCATGGACAATATGGCGCGAGTGACGCTTGAGCTCGGCGGCAAATCACCAGTAGTTATCCTTGAAGACTATGACCCCGAGCAAGCTGCTGCCCAAGCCGCCCAGGCGATATTTTTCAATCACGGCCAAGTGTGTTCGGCGGGCTCTCGTTTGTACGTCCATAAAAGCAAGTACGACAGTGTCGTTGGTCAATTGGCAAACTTGGCCGATACCATCAAGCTGGGTCACGGGCTGGATCCCGCACATCAAATGGGTCCGTTGGTTTCCAAGCGGCAGATGGATCGAGTTTGTGGATATATCAATATCGGTCAAGAATCCGGCGCGGAGCGGATTACCACCGCAAACAGCACACCGGAGCGCGGCTACTTTGTGCAGCCAACGGTGTTTGCCAGTACCAATGATAAGCTGGAAATAGTTCGCGAAGAAATTTTCGGCCCGGTGGTGGTCGCTATGCCCTACGACGACCTCGACGATGTTGTTCGGCGTGCGAATGATACGCCTTACGGCCTAGCAGCGAGTATCTGGTCTAACGATCTTTCGCGTGTCCACAAACTCGTCCCTCGTTTGAAGGCCGGCAGTGTGTGGGTGAATTGCCACAATATGCTGGATGCCGCAATACCGTTTGGTGGCTACAAGATGTCTGGCTTTGGTCGAGACATGGGGCGTCAATCATTGGATGCTTATCTAGAGACCAAGTCAGTAGTTATGGCTTTTTTTCTTTACGCGAATATTTATAATCAAGGAACATCAATGACGCTTTCTTATACTCAGGGGTCAACTTTGACTCCCTTGTTGGAAAAGACAATTGGCGAGGCATTTGAAGATACCGTTCAGAGGTATGGAAGTTGCCTCGCACTGGTTGATCGCCACCAGAGGCTACGGTTTACCTGGGCGGAGCTGGGACAGCAGGTTAACGATTATGCTCGTGCAATGATGGCCCTGGGCATCAATCCCGGAGATCGGGTTGGTATTTGGGCACCAAATTGTACAGAGTGGTGCATCGCCCAATTCGCCACGGCAAAAATCGGCGCTATTCTCGTTACGATAAATCCCGCCTATCGCCTAGAGGATCTGCGATATGCACTTAAGCAGTCGGGCTGCAAGTGGCTTATTTGTGCCGATAAATTCAAAACCTCTGACTACCACCAGATCATACTTGAGCTGATATCAACAGCTGCCACAAGTGAAGTGGGTGAAGTAAACGACAAAAACGCGCCTCAATTGCGGGGTTTGATTAGTCTGTCCGAGAATCCACCAGCAGGATTTCTATCGTGGCCGGATTTAGCTACACGTGCTGAGGGAGTCTCCTATCAGGCCTTATACGAACGGGAAGCTTCCCTGGACGCCAATGACCCAATAAATATTCAGTACACATCAGGTACCACTGGCTTTCCAAAAGGTGCAACACTCAGCCATCGAAATATTCTTAACAATGGTTATTTTGTCGGTCAAAGTCTGAGCTTGACAGAAATCGATCGTTTGATCATTCCAGTGCCGTTATACCATTGCTTCGGTATGGTGCTGGGCAACCTGGCTTGTATCACCCATGGTTCTGCCATGATTTATCCCGGCCCTGGGTTTGACCCGGAAGTCACGCTCCAAACGGTAAGTGATGAAGGGGGCACCGCTCTTTATGGCGTCCCAACAATGTTCATCGCTGAGCTCGCACATCCGGAGCTCGACAAGTTCAATCTCTCAACATTGCGGACAGGGGTCATGGCCGGCGCCAACTGTCCAGTCGAAGTGATGACCAAGGTCATTGAAAAGATGCACATGGCTGAAGTCCAGATTGCTTACGGTATGACGGAGACCAGCCCTATCTCGACCCAAACGGGCGCAAACGATGAGTTGGAGCGTCGCATTAGCACGGTGGGCCTCACCCAGCCACATCTGGAAACCAAGATTATTAACCGGGAGGGTGAAACGGTCAGCCGGGGTGAAGTTGGGGAGCTATGTACCCGAGGGTACTCCGTGATGCTAGGCTATTGGGAAAACCCTTCGGCCACAGCGGAAGCGATCGACAATAATGGCTGGATGCACAGCGGCGATCTCGCGGTCATGGATGATGAGGGTTTTATCTCTATTGTTGGGCGGGCGAAGGACATGATTATCCGCGGCGGCGAGAATATCTCGCCCCGTGAAATCGAGGAATTCCTTTATACCCACCCCGGCGTAGAGGACGCTCAGGTAATTGGTATTTCTGACAAGCAATACGGCGAAGTCGTAGTCGCATGGGTCAAGCCAAAGGCTGGCGCCACGCTGGATGAAAACGAGCTGCGGAGCTACTGCCAAGGCAACATTGCCTATTTCAAAGTGCCGAAATGGTTCCGTTTCGTGGACGAGTTTCCAATGACTGTAACTGGGAAAATTCAGAAGTACCGCCTAAGGGAAATTAGTGAAAGGAGCATAGAGGAGCATGGCAGGGCGTGA

Transcript

ANN30829-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O31826	Putative acyl-CoA synthetase YngI OS=Bacillus subtilis (strain 168) OX=224308 GN=yngI PE=3 SV=1
O34660	Putative aldehyde dehydrogenase DhaS OS=Bacillus subtilis (strain 168) OX=224308 GN=dhaS PE=3 SV=1
Q4R4Z9	Medium-chain acyl-CoA ligase ACSF2, mitochondrial OS=Macaca fascicularis OX=9541 GN=ACSF2 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001690 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13193 all species →	AMP-binding_C	AMP-binding enzyme C-terminal domain	Domain	Interproscan
PF00171 all species →	Aldedh	Aldehyde dehydrogenase family	Family	Interproscan
PF00501 all species →	AMP-binding	AMP-binding enzyme	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR029510 all species →	Conserved_site	Aldehyde dehydrogenase, glutamic acid active site	Interproscan
IPR025110 all species →	Domain	AMP-binding enzyme, C-terminal domain	Interproscan
IPR016162 all species →	Homologous_superfamily	Aldehyde dehydrogenase, N-terminal	Interproscan
IPR042099 all species →	Homologous_superfamily	ANL, N-terminal domain	Interproscan
IPR016163 all species →	Homologous_superfamily	Aldehyde dehydrogenase, C-terminal	Interproscan
IPR020845 all species →	Conserved_site	AMP-binding, conserved site	Interproscan
IPR015590 all species →	Domain	Aldehyde dehydrogenase domain	Interproscan
IPR016161 all species →	Homologous_superfamily	Aldehyde/histidinol dehydrogenase	Interproscan
IPR016160 all species →	Conserved_site	Aldehyde dehydrogenase, cysteine active site	Interproscan
IPR045851 all species →	Homologous_superfamily	AMP-binding enzyme, C-terminal domain superfamily	Interproscan
IPR000873 all species →	Domain	AMP-dependent synthetase/ligase domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11699 all species →	ALDEHYDE DEHYDROGENASE-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016491 all species →	Molecular Function	oxidoreductase activity	Interproscan
GO:0016620 all species →	Molecular Function	oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor	Interproscan
GO:0008957 all species →	Molecular Function	phenylacetaldehyde dehydrogenase (NAD+) activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for ANN30829-RA.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora grisea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora grisea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →