Gene detail

Detailed information of ANN31200-RA in Montipora grisea

Genomic Location: Scaffold_247__1_contigs__length_133253:23090...25588
NR annotation: RKU15415.1, excinuclease ABC subunit B [Candidatus Poribacteria bacterium]
Species Montipora grisea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN31200-RA

ATGAGAGAGAACTGGGAATTACTGACCAAGATTGATGATCCAGGAGATGAGGTTTCGGAACTGGATAACCCGCAATTTGAACTCATCTCAGACTTTTCACCACAAGGCGATCAACCCGAAGCCATTGACAAACTCACAAAAGGGCTCCAACGTGGAGACAAAGCACAGACACTCCTCGGCGTGACGGGTTCAGGAAAGACCTACACGATGGCGAATGTAATTGAGAACGTCCAATTGCCCACACTCGTCATCTCACCGAATAAGACACTCGCCGCACAACTTTACAACGAGTTCCGGACGTTTTTCCCAAATAACACTGTTCACTATTTCGTCAGTGATTACGAATACTATCAACCTGAAGCATATATCCCGTCCACGGATACCTTTATTGAAAAGGATGTCCGCATTAACGAAGAAATTACACGGATGCGGCTCGCTTCAACAGCGTCCTTAATATCGCGTCGCGATGTTATCGTTGTGGCGAGTGTTTCCTGCCTGTACGGTCTCGGTTCACCGGATGAATTTGAAAATCAGAGGGTCCAGGTAACCGTTGGCGATGTTGTTCGGCGCGACGCGCTCCTACGAGCCTTAGTCGATATTCAGTATGTCCGCAACGATGTTGAGTTCTGGCAAGGTGTGTTCCGCGCTCGCGGTGATGTTGTTGAAGTCTTTCCTGCTTACAGTGAGAACGCCTATCGTATTGAGCTTTTTGGCGACGAAATTGATCGAATTAATGAAATTGATACAACAACAGGAGAGGTGTTGGCACAACGGGATTTTCTTGAAATTTATCCCGCCAAGCATTTCATGACGGATGGCGACATCTTCGATCAGGCATTAATCAATATTGAACTTGAACTTCAAGACCGCATTCTGACTTTCGAGAAAGAGAATAAATTGCTGGAAGCACAACGCATCGAGCAACGAACCCGATTTGACTTGGAAATGTTGCGGGAGGTGGGCTACTGCTCCGGTATTGAAAATTACTCACGGCATCTCTCAGGATTACAACCGGGGGACCCGCCCTATTGCCTGATGCACTACTTTCCAGACGATTTTCTTCTTTTTATTGATGAGTCTCATGTAACCATCCCTCAATTGCGGGGTATGTATCGCGGTGACCGGTCTCGGAAGGAGACGCTTGTCAACTATGGTTTCCGTTTGCCCTCTGCCTTGGATAACCGTCCGCTTCGGTTCGACGAGGTGGAAGCGCGGGTCAACCAGGTTATCTTTGTCTCGGCGACCCCTGGTCCCTATGAAATGGATAACAGTGCGCAAATCGTCGAGCAGATTATCCGTCCTACTGGACTCATCGATCCCGAGATTTCGATACATCCAGTGAGGGGACAAATAGACCATCTCATTGGCAAAATCCATGAGCGCGTCAGGAGCAAACAACGTGTCCTCGTCACGACGCTTACCAAACGGATGGCGGAGGACTTAACCGAGTATTTGACTGAGGCGGGTATCCGTGCTGACTATATGCATTCAGAGATCGATGTGTTCGACCGTGCCCGTATTCTGCGTGAACTTCGCGAGGGTGTTTTCGATGTGTTGGTCGGTATCAACTTACTCCGAGAAGGGCTTGACCTTCCTGAAGTTTCACTCGTTGCGATCCTTGATGCTGACCGTCCGGGTTTCCTCCGTTCTGTCAGATCTCTCGTCCAAACCGCTGGACGGGCAGCGCGAAATGTCGACGGTGAAGTCCTCTTGTACGGAGATGACGTCACAGATGCCATGGGAGCCGCGATCAAGGAAACGCGCCGCCGCCGTGAGATTCAACTTCAGTATAATACCGATAACAACATCACACCCGCGACAATAGAAAAGGCTATTCAGGAACTTATCGCTGAATCAACTGAAGAGTATAAGACTGAAAAATCTGACAAGTCTGCTATCATCCCAGAAACCATTGAACCGCAAGACATTGAAGCGACTATTACGGACTTAACGCGACGCATGCGAAAAGCGGCGTTGGATCTTGATTATGAAGAGGCCGCCGCTTTACGTGACCAGATTGCTGAGATGAAAGCGCAATCAGCGGAGCAGCCAGAAAAGAGAAAGGACTTTACAATGTTTGTTTGTGTTGCTTGTGGCTATTTGTGGAAAGAAGCAGATAGTCCACCAGAAGAGTGTCCGGCGTGCACGGCACCGAAAGAAAAATACATTCCTTATGATGATAGAGCAGAACGTTGGGTCAAGCGTGCTGTCGCGGCACATGTTATGTACCCGGACGAAGACGGCGCAGACCTCCGCGCAGAGAACTCAGCACTCTCGTCTCACATTAGATTTGCTCTTGTTGGGTTACTCGGTGATATTGAGAAAGGATAA

Transcript

ANN31200-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
B9MS82	UvrABC system protein B OS=Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320) OX=521460 GN=uvrB PE=3 SV=1
Q8R8M4	UvrABC system protein B OS=Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4) OX=273068 GN=uvrB PE=3 SV=1
A4XKY5	UvrABC system protein B OS=Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331) OX=351627 GN=uvrB PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0011322 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF04851 all species →	ResIII	Type III restriction enzyme, res subunit	Family	Interproscan
PF12344 all species →	UvrB	Ultra-violet resistance protein B	Family	Interproscan
PF21349 all species →	RUBY_RBDX	Rubrerythrin, rubredoxin-like domain	Domain	Interproscan
PF02151 all species →	UVR	UvrB/uvrC motif	Family	Interproscan
PF00271 all species →	Helicase_C	Helicase conserved C-terminal domain	Domain	Interproscan
PF17757 all species →	UvrB_inter	UvrB interaction domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR006935 all species →	Domain	Helicase/UvrB, N-terminal	Interproscan
IPR004807 all species →	Family	UvrABC system, subunit B	Interproscan
IPR001650 all species →	Domain	Helicase, C-terminal domain-like	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR024759 all species →	Domain	UvrB, YAD/RRR-motif-containing domain	Interproscan
IPR048574 all species →	Domain	Rubrerythrin, rubredoxin-like domain	Interproscan
IPR014001 all species →	Domain	Helicase superfamily 1/2, ATP-binding domain	Interproscan
IPR001943 all species →	Domain	UVR domain	Interproscan
IPR041471 all species →	Domain	UvrB, interaction domain	Interproscan
IPR036876 all species →	Homologous_superfamily	UVR domain superfamily	Interproscan
IPR024934 all species →	Domain	Rubredoxin-like domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24029 all species →	UVRABC SYSTEM PROTEIN B	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0016787 all species →	Molecular Function	hydrolase activity	Interproscan
GO:0006289 all species →	Biological Process	nucleotide-excision repair	Interproscan
GO:0009380 all species →	Cellular Component	excinuclease repair complex	Interproscan
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005506 all species →	Molecular Function	iron ion binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K03702	uvrB; excinuclease ABC subunit B	-	DNA repair and recombination proteins	ko03400	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora grisea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora grisea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →