Gene detail

Detailed information of ANN32474-RA in Montipora grisea

Genomic Location: Scaffold_4539__1_contigs__length_31932:15725...23880
NR annotation: MBF0277998.1, DNA gyrase subunit A [SAR324 cluster bacterium]
Species Montipora grisea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN32474-RA

ATGTCAGGAGAAAACCCATACCTCGCAGATGTTGAAGTAGAACTTCCTCAAAAGCCTTACCGTATCACTGTGAAAGGTGATGCTAAAGAGCAAGTGATCTCTGTAAACCCTGATGAATTAGATGAAAATGGAATAGGGTTGCAAGGTTCTATATTGGATATTTTAGAAAAGGAAGGGATAGAAGTTGATCATGCTTGTGGCGGTTTATGTGCATGTTCCACTTGTCATGTCATTGTGCATGAAGGTTTAGAAACATGCAATGAAGCAACAGAAGATGAGGAAGATATGTTAGATATGGCACCGGGTCTGTGTTCCAAATCACGCCTTGCATGTCAGGTTGTTCCCAATGGTTCAAAAACAGCAGCAAAGCAAATTCAAAAAATTTTAGTCCAACAGAATGTGCGAGAAGGTGAAGCCAAAATCAGAGTTGGTGTCAAAGGAGGTGGTTGCTCTGGTTTTACATACACCTTTGAATTTGATACGCAGAAGCGAAAGTTTGATTTAGAATTTGAATCACAAGAAGTTGAGGTTCACGGCTCTCATGCATCCATTTCCGTTACATCATCTGTTTTTGAAGGAAAGCGTATTTTAGAAAAGCAACGACTGGTCTATGATGTGCTCAAACCTTTCATGTCAGATATTTCTGAAGAGATGCGTGATTCCTATATGGAATACGCTATGAGTGTGATTGCAGGTCGGGCATTGCCAGATGTCCGTGATGGCTTAAAGCCTGTGCATCGTAGAATCCTTTTTTCTATGAATGAACAAGGTAATGACTATAATAAACCTTATCGTAAATCTGCAACGGTAGTAGGTGATGTCATGGGTAAATATCACCCTCACGGAGATTCTGCTATTTATGATTCTATGGTGAGGCTCACACAAAGTTTTTCTACACGTTATCAACTGATTGACGGACAAGGAAACTTTGGATCAGTAGATGGTGATTCTCCTGCCGCTATGCGTTATACAGAAGTTCGTATGAATCAAATTACAGGTGAACTTTTGGCTGACCTAAACAAAAATACTGTTGATTTCACCCCAAATTATGATGATTCTAAAAAAGAGCCCACTGTACTACCTTCTAAAATTCCAACACTGCTTTTAAATGGATCCATAGGAATTGCAGTTGGAATGGCATCAAATGTTCCTCCACACAATTTAAGCGAGGTGATGAATGCTTTTCTATATTACATAGATCATCGTCATGATCCAGACCTTTTAGAAATCATGAAGATTATGCCCGGTCCAGATTTTCCGACAGGCGGAACAATTATGGGAACACAAGGTATTTATAGTGCCTATTCTACAGGACGAGGAATTATTAAAATTCGTGCAAAAACTCATATTGAGACAGAAAAAGAACGGTCTGCCATCATTGTTACAGAGCTTCCTTATATGGTGAATAAGGCTAATTTACTTGAAAAAATTGCTGAACTTGCACGAGACAAAAAGCTAGAAGGGATTTCAGATTTAAGAGATGAGTCAGATCGCAAGGGAATGCGGGTTTTTATTCAAGTCAAACGAGGTGAAAACCCTCAAGTTGTATTGAGTAATCTCTATAAACACACTGCAATGCAATCCTCTTTTGGTGTGATTATGCTTGCCATTGTGGATCGTCAACCCAAAATCTTGCCTGTGGTTCAGGTCTTCAAATATTTCTTAAAACATCGTTTTGAAACAATTACAAGACGTATCCGTTATGATTTAGAAAAAGCAGAGGCTCATGCTCATATCTTACTTGGACTCTCCAAAGCATTGGATCATTTGCAAGAAGTGATAGACCTGATTAAAGCATCAGCAAACCAAGAAGAAGCAAAGGATGCATTGAAAAGAACATTTGACCTTTCACCCAAACAATCACAAGCTATTTTAGAAATGCGTTTGCAACGTCTTACAGGATTGGAACGTCAAAAAATTGCTGATGATCTTGCCAAAACACAACAAGCCATTGAAGAATTTCGCTCTATTCTTGCTGATGAAAATAAGGTGCTTGCCATTATTCGTGAAGAATCTTTGCAAATCATTTCAAAATATGGAGCAAATGATTACAGACGATCTGAAATCTCAATGGAAAGCAGTGATATTTCTATTGAGGAGCTGATTACTTGTGAAGATGTAGTGGTCACCATTTCACGAAGTGGATATATAAAAAGAAGTCCTGTGAATGAGTATCGTGTCCAATCGCGTGGAGGCAAAGGTCGTATAGGTATGGCAACCAAAGATGAAGATTTTGTTGAAAAAATGTTTGTTGCTTCTACTCACGATGTTTTGTTAAGTTTTACTACTTTCGGAAGAGTGTTTGCGATCAAAGTCTATGAAATTCCTCCATCAGGACCAAATAGCCGTGGCAAAGCCATTGTCAATTTATTGCAGTTGGAATCTAATGAAAAGATTTGTGCTTATTTAAATATTTCAGCATTTGAAGAAGGCAAATATATTGTGTTGGGTACGTCTGCAGGAATTTGTAAAAAAACAGCATTAGTCGCATTTAAAAATATCCGTAACAAAGGATTGCGTGCCATCAACCTTGATGAAGATGATACAATGATTTCTGCTCAACTGACAGATGGTTCACAAGAAATTTTTATTTCTACAAGAAATGGAATGGGTATCCGATTTCCTGAAGATAATTTGCGTCCGATAGGAAGAGCTTCACGAGGTGTAATAGGAATCAGGATGAAACAAGATGATTCTGTCTTGAGTATGCGTGCATTAACACAATCTGAAACCATTTTAACTGTAACAGAAAGAGGCGTTGGTAAGCGAACATATCTTGAAAATTTCAACCTGCAAAAAAGAGGTGGCAAGGGTTTGATTATTCTCAAATCTACTGCTCGTACTGGTAAAGTAGTAGGAGCTTCAGAAGTGGGAAAAGATACAGAAATTTTACTCATGACTAAAAGTGGAAAATTAATTCGTATTAGCTCTTCTCAAATTAGTGTGATTGGTAGAGTAACACAAGGGGTGAAGCTCATTGATATTGATAAAGATGATCGTGTCATAGACTTTGCTATTGTGCCTCGTGATGAAGATCAGGAGGCGGAAAATACCCAAATTGCAGTCTCTGGAATTTTTGGTGAATCTGAGGAGTTGAAAAAAATTGCAGTTTATGCCACTACAAATCACCAATTACAAGTTGTAGTGCAAGAAGAAACTGTCAGCTTTTTAGGAAACAAAACAATTGAGGAAACACAGGCTTATCTGGAGCTGACTGAGAAGCAACAAATGACAGCACTGGCTCTTGGACAAGCAGGAGAAGTCATTTTTGTAGGTACAAATTCAGGGCAACTTTTTCATTGGGATATTTCAGACATAGAAGAATCGAAATTTTTAGGCGAGATTCAAACAGGTTCTCAAAGTGCTGTAAGTGCAATGGAGTTTGCAGTTGGTCAAATGTCACTAGTTGTTTCATATCAAGATGGAACATCAGAAGTTTATAGTGTTTTTACCAATGATAAAGAGGAAATGGAGGCATTTCATGGTCAAAAGAACAATCTCTGCAAATCTGGAAGCTGGATAATCCGCATCCTGAAATCAGTTGGAAAGCATTATTTGGTGAGATTTGAAGATGCACTTTCTAATGTTCCCACAAGTCTGAAAGCAGCATCTTATGCACTGGGAGCAAGTCGTTGGCAAACAGCAGCACGTATTACATTACCTGCTGCAATATCAGGAATCTTTGCAAGTATCATTATTGGTCTAGGGCGTGCTATTGGTGAAACTATGGTTGTCTTGATGACAACAGTGATTGGAATCATTTTTATCAGAGGTAGCAGCACTTTTTGGATTGATAATCTTGCTTTGGTCAAAATGAAAGAGGCAAAACCTGTGCTAGCAAAAATTCTTGAAGAACAAACCAATGCTGACACTGGAAACGTGCAAATCAGATTGAAGGTCGGAAATCGTGAGCTTTACGGACTGGATTTCCGCTGGGTCAATCGTGATGACATTTTAGATTCTTCATATCCTGCTGATGCCATTGCTATTGAACGTTATGAATATGGCGATTTTCATGGTTTTCTCAAAAAATTCAATCTCCCAAACCTTTGTCTGGTGACTTATGGCAACAGCTTAAGCAAGCACAAGAGGCATTTGATTCTCTTGGTTTAG

Transcript

ANN32474-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P94605	DNA gyrase subunit A OS=Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W) OX=272562 GN=gyrA PE=3 SV=2
P05653	DNA gyrase subunit A OS=Bacillus subtilis (strain 168) OX=224308 GN=gyrA PE=1 SV=1
O50628	DNA gyrase subunit A OS=Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125) OX=272558 GN=gyrA PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0010946 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03989 all species →	DNA_gyraseA_C	DNA gyrase C-terminal domain, beta-propeller	Repeat	Interproscan
PF00521 all species →	DNA_topoisoIV	DNA gyrase/topoisomerase IV, subunit A	Family	Interproscan
PF00528 all species →	BPD_transp_1	Binding-protein-dependent transport system inner membrane component	Family	Interproscan
PF01722 all species →	BolA	BolA-like protein	Family	Interproscan
PF00111 all species →	Fer2	2Fe-2S iron-sulfur cluster binding domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR013760 all species →	Homologous_superfamily	DNA topoisomerase, type IIA-like domain superfamily	Interproscan
IPR036010 all species →	Homologous_superfamily	2Fe-2S ferredoxin-like superfamily	Interproscan
IPR001041 all species →	Domain	2Fe-2S ferredoxin-type iron-sulfur binding domain	Interproscan
IPR006691 all species →	Repeat	DNA gyrase/topoisomerase IV, subunit A, C-terminal repeat	Interproscan
IPR000515 all species →	Domain	ABC transporter type 1, transmembrane domain MetI-like	Interproscan
IPR002205 all species →	Domain	DNA topoisomerase, type IIA, domain A	Interproscan
IPR035906 all species →	Homologous_superfamily	MetI-like superfamily	Interproscan
IPR036065 all species →	Homologous_superfamily	BolA-like superfamily	Interproscan
IPR001055 all species →	Family	Adrenodoxin-like	Interproscan
IPR035903 all species →	Homologous_superfamily	HesB-like domain superfamily	Interproscan
IPR013757 all species →	Homologous_superfamily	DNA topoisomerase, type IIA, alpha-helical domain superfamily	Interproscan
IPR005743 all species →	Family	DNA gyrase, subunit A	Interproscan
IPR002634 all species →	Family	BolA protein	Interproscan
IPR012675 all species →	Homologous_superfamily	Beta-grasp domain superfamily	Interproscan
IPR011047 all species →	Homologous_superfamily	Quinoprotein alcohol dehydrogenase-like superfamily	Interproscan
IPR035516 all species →	Homologous_superfamily	DNA gyrase/topoisomerase IV, subunit A, C-terminal	Interproscan
IPR050220 all species →	Family	Type II DNA Topoisomerases	Interproscan
IPR013758 all species →	Homologous_superfamily	DNA topoisomerase, type IIA, domain A, alpha-beta	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR43493 all species →	DNA GYRASE/TOPOISOMERASE SUBUNIT A	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003918 all species →	Molecular Function	DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0051536 all species →	Molecular Function	iron-sulfur cluster binding	Interproscan
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0003916 all species →	Molecular Function	DNA topoisomerase activity	Interproscan
GO:0006265 all species →	Biological Process	DNA topological change	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0055085 all species →	Biological Process	transmembrane transport	Interproscan
GO:0051537 all species →	Molecular Function	2 iron, 2 sulfur cluster binding	Interproscan
GO:0140647 all species →	Biological Process	P450-containing electron transport chain	Interproscan
GO:0005694 all species →	Cellular Component	chromosome	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0009330 all species →	Cellular Component	DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) complex	Interproscan
GO:0006259 all species →	Biological Process	DNA metabolic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for ANN32474-RA.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora grisea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora grisea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →