Gene detail

Detailed information of ANN32783-RA in Montipora grisea

Genomic Location: Scaffold_4476__1_contigs__length_32141:431...2656
NR annotation: MXZ34786.1, carbamoyl-phosphate synthase large subunit [Acidobacteriota bacterium]
Species Montipora grisea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN32783-RA

ATGCCCAAGAGATCGGACATCAAGAAAATTCTGGTCATCGGTTCGGGTCCGATCGTGATCGGGCAGGCCTGCGAATTCGACTACTCCGGCACCCAGGCCTGCAAGATCCTCCGGGCCGAGGGCTACCGGGTGGTTCTGGTGAATTCGAACCCGGCCACCATCATGACCGACCCCGAGCTGGCGGACCGGACCTACATCGAGCCGCTCACCCCGGAATACCTGGAAGCCATCATCCTGGAAGAGAATCCCGACGCCCTGCTGCCCACCGTGGGCGACGGCGCTCAATCTAGCGGTGGCGCTGTCGGAACGGGGCGTTCTGGACAGGCGGGAGTCGAACTGATCGGCGCCCGGATCAGGTCCATCAAAGTGGGCGAAGACAGGCTGCTCTTCAAGGAGGCCATGCGGGAAGTCGGCCTGGAGACGCCACGCAGCGGCGTGGCCTACGATTTCCGGGAAGCCCGGCAGATCGTCCGGGAGGTGGGCTACCCCGCCATCATCCGGCCGTCGTTCACCCTGGGAGGCACCGGGGGCGGCATCGCCTACAACGCCGAGGACTGGCCCGGCGTGGCCTCGACTGAGCCCGGCGCACGAGATCCTGATCGAGGAATCGGTCATCGGCTGGAAGGAATTCGAGCTGGAGGTGATGCGGGACCTGAAGGACAACGTGGTGGTGATCTGCAGCATCGAGAACTTCGACCCCATGGGGGTGCACACCGGAGATTCCATTACGGTTGCTCCGGTCCAGACCCTCACCGACAAGGAATACCAGCACATGCGGAACGCGGCCATCCGGGTCATGCGCAAGGTGGGGGTGGAGACCGGAGGATCCAACATCCAGTTTGCCGTCAACCCGAGGGACGGGCGGCTCGTGGTGATCGAGATGAACCCCCGGGTTTCCCGCAGTTCGGCCCTGGCCTCAAAGGCCACCGGCTTTCCGATCGCCAAGATCGCCGCCAAGCTGGCGGTCGGGTTCACGCTGGACGAGATCCCGAACGACATCACCCGGAAGACCCCGGCCTGTTTCGAACCCACCATCGACTATGTGGTCACCAAGATCCCCAAGTGGGCCTTCGAGAAGTTCCCGGAAGCCGAGCCGCTGTTGGGAACCCAGATGAAGTCGGTGGGGGAGGTCATGGCGATCGGCCGGACCTTCAAGGAGTCCCTGCTCAAGGCCATGCGCTCCCTGGAGACCGGCCGCAAGGTCGGTCGCAGAAGCTGGACCCGGATCAGATCCGAGAGAAACTGATCACCCCCAATCCCGACCGTCTTCTCTATCTCCGGTTCGGGTTCGAGCACGGCCTGTCGGTGGAGGATGCCCATCAGTACACGCAGATCGACCCCTGGTTCCTCCGCCAGGTCCGCGAGATTTCCCGGCTCTCGGCCAGGCTCCAGAACACCGATCTGTCCGGAATCTCTCCCGGGCAGTTCCGGCAGGCCAAACGCCTCGGCTTCTCGGATCCCTACCTGGCCTGGCTGACCCGTTCCACCGCCGCCGAGGTGCACCGGCTGCGGCAGAGACTGCAGATCCGCCCGGTCTACAAGAGAGTGGACACCTGTGCGGCCGAGTTCGAGTCCTTCACCCCCTACCTCTACTCCGCCTACGAACAGCAGTGCGAGGCGGAACCCACCCGGAGAAGGAAAGTCGTCATCCTGGGCAGCGGGCCGAACCGGATCGGCCAGGGCATCGAGTTCGACTACTGCTGCTGCCACGCTTCCTTCGCCCTCAAGGAGGACGGCTTCGAGACGATCATGATCAACTGCAACCCGGAGACGGTGTCCACGGACTACGACACCTCGGATCGCCTCTACTTCGAGCCTCTGACGTTCGAGGACGTCATGCACGTGGTGGATCTGGAAAGGCCCGACGGGGTGATCGTCCAGTTCGGCGGCCAGACCCCCCTGACCCTGGCCCTGTCCCTGCAACGGGCCGGAGTCCCCATCATCGGCACCTCTCCCGAGTCGATCGACTTGGCCGAGGATCGCCAGCGGTTCGGCAGACTGCTCTCCCAGATGGGCATTCCCCAGCCTCCCTCGGGCACGGCCACCTCCTACCGGAGAGCTGCGATCATCGCCGAACGCATCGGATACCCCGTCCTGGTCCGGCCCTCCTACGTCTTGGGCGGGCGGGCCATGGTGATCGTGCACGACGACCGCTCCCTGGAGCGGTACATCGGCGAGGCGGTCGGCGTCTCCCAGGACGTCCGATCCTGA

Transcript

ANN32783-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
C1F1S6	Carbamoyl phosphate synthase large chain OS=Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161) OX=240015 GN=carB PE=3 SV=1
Q1IPK2	Carbamoyl phosphate synthase large chain OS=Koribacter versatilis (strain Ellin345) OX=204669 GN=carB PE=3 SV=1
Q87EB8	Carbamoyl phosphate synthase large chain OS=Xylella fastidiosa (strain Temecula1 / ATCC 700964) OX=183190 GN=carB PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001105 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02786 all species →	CPSase_L_D2	Carbamoyl-phosphate synthase L chain, ATP binding domain	Domain	Interproscan
PF02787 all species →	CPSase_L_D3	Carbamoyl-phosphate synthetase large chain, oligomerisation domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR005483 all species →	Domain	Carbamoyl-phosphate synthase large subunit, CPSase domain	Interproscan
IPR005479 all species →	Domain	Carbamoyl-phosphate synthetase large subunit-like, ATP-binding domain	Interproscan
IPR013815 all species →	Homologous_superfamily	ATP-grasp fold, subdomain 1	Interproscan
IPR005480 all species →	Domain	Carbamoyl-phosphate synthetase, large subunit oligomerisation domain	Interproscan
IPR016185 all species →	Homologous_superfamily	Pre-ATP-grasp domain superfamily	Interproscan
IPR036897 all species →	Homologous_superfamily	Carbamoyl-phosphate synthetase, large subunit oligomerisation domain superfamily	Interproscan
IPR011761 all species →	Domain	ATP-grasp fold	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11405 all species →	CARBAMOYLTRANSFERASE FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006807 all species →	Biological Process	obsolete nitrogen compound metabolic process	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0004088 all species →	Molecular Function	carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0006541 all species →	Biological Process	glutamine metabolic process	Interproscan
GO:0046872 all species →	Molecular Function	metal ion binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for ANN32783-RA.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora grisea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora grisea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →