Gene detail

Detailed information of ANN32789-RA in Montipora grisea

Genomic Location: Scaffold_4140__1_contigs__length_33237:15604...19733
NR annotation: WP_089372988.1, S8 family serine peptidase [Dokdonia pacifica]
Species Montipora grisea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN32789-RA

ATGAATAAAGATCATGCTGAAACGCAAGCTTTATTAACAGCTCTTAAAGCAAAGCAAAATACTGGAGATGCTCAAGTTATTGTAGCGCCTACTTCAATCAATTTATATGCAACTACAACTGAATTAGAAGGTAGTGATATTCAAGTAGCTGCTCAGAATATGCATCAGGCAGAAAGTGGTGCATACACTGGTGAAATTTCAGCAAATATGATTAAAAGCATTGGTATTAATACTGTGATTCTGGGACATAGCGAGCGACGTGCTTATTTTCATGAAGATGATACTTTATTAACACAAAAGGTAAACACTGCCATTGCTCATGGGTTTACTGTTATTTTCTGTTTTGGTGAAGAACTGGAAGATCGTAAAAACGGAAAGCATTTTGAGGTCGTAGAGAAACAGCTTAAAAACGCACTTTTTCATCTTACAGCGACACAATGGTCACAGATTGTATTAGCTTACGAGCCTGTATGGGCTATAGGTACTGGAGAAACAGCTTCTCCTGAACAAGCGCAGGAAATGCATGCTTTTATCCGTAAAACAGTTCAAGATTCTTATGACACTACTACAGCAGATCAAGTTTCTATTTTATATGGAGGTTCTGTAAAACCAGGTAATGCCAAAGAGATTTTTTCAAAACCAGATGTAGATGGAGGTTTGATAGGTGGAGCCTCTCTTAAAGCTGATGACTTTTTTGATATCATACTTACAAATGCTGATGGATCTATTACACTTCTTGAAAATGAAGAAAAAAATGCAGTATATCTTACTAAAGATGGACATCTAGGAATTGGCAAAAAGAACCCTAAAGATAAGCTAGAAGTAAATGGGCAAATTCATGCAAAATCTGCAAAGCTGGATCTTAAAGAATGGGCAGATTACGTATTTGAAGATGGATATAATTTATTACGCTTACGCGAAATCGAAAACTACATCAACACCTATGGTCATTTACCTGAAGTCCCCACTACTAAGGATGTTCAAGAAAATGGTATTGAATTAGTAGATGAGCATATTGAGATTCCTGTTATAACTAAAGATTCATCTGTTACTTATGCAGGAGATCACATAAAACTAAAATCTTTATTTCAAAAATACGATGTAAAAGTATTTAGAAAAGGATTTAAATATGCCGAAAGAGACAAATTAAAACGTACTTATTTTGTTATTGCTTCAAGTCCTGATTTTCAAAAAGCAATATTAGAAGAAGTACCAGATATTTTTGAATTTGGCGAAAGCCTAGAACCCGATAAACTTAAAATATATGAACCTAATGACTATGGTATCACAAGTACTATAAGCGGTAATCAGGGCTTACAAGTAAACCTTGATTATCTCGATTTTTTAGGCGTTCCTGAAGCATGGTATTATACCACTGGAAGTAAGGATGTAATTATAGGTATTTCCGATGGTTATGTAGATCCAGAAGATCCCGAATTTAAAGATAGAGTTACTGTATTTAAGAAAAGCTCCTACTCAAAAGGACATGGTATGAGTGTTGCAGCTACTGCTGCTGCTAGTGGGAATAATGGATACGGGATCGTAGGAGTTTGTTCTGATTGTAGCATCTACACAACTACGTATGGGGATTTCAAATTTTTAAATCAATTATTAGAATTATCTCGTGCAGGTGCAAAAGTTATTAATTGTAGTTGGGGAAGTACGCGTTATTACGAAACTGCTCAAGAAACTATTAACGAAATGAGAGATAATGGAACCGTTATTGTTTCTGTCCCTCATAATGCTTCTTTTAAAACAACAAAAGGAAAAGCACCTAGGTATCCAGGTGCTTATGAACATGTTATTTCTGTAGGTAGTATTCAACATCGATTTGATGATCCTAAAGAAACTATTCATACTAATGGAAAAGGAAATCCATTTGCTATTGGTTTAAAATATTATGTAGGCCGAGCTGTTGGCTTTAAAGGAAATGATATTAATGGCGAACAATTTATTTACCAAGCTTCTACAAATAATTTAGATCCTTATGTAGATATCCTAGCCCCTGAGCCTCCTACCCCTGCTACTGAAATATTAATAGCAGAATTAGGTTATGCCGGTTTTGAGAGTTTTACAGAAACAGAAACCGGAGTAATTGCTTATATTCAAAAAGAAGAAGCATTTCCTAATAATACGCCTGTAGATTTTAAGAGTTTACTTACAGACATCCAAATTCTCCAATCTGATGAATTTCAAATTTCATATACTGCTCAAGAAATTGAACAAGTAAATTGGAATGAAGAATGGGAAAAGAATTTTGACCCAATCGAAGTTGATGGACGCTGTGCTGTGCGTGCTCCTTTTCATCCAAAAACAGAAGTTGAGTTTGATATTGTCATAGAGCCTAAAATGTCGTTTGGAACTGGTCATCATGAAACCACACATATGATGATTAAACATCTTTTGAAACTTGATGTATCAGGTATGAAGACATTAGATATGGGATGTGGCACAGGTGTTCTTGCTATTCTAGCAGAAATGAAAGGTGCACAACCTATTGATGCTATAGATATTGATAATTGGTGTTATCTAAACTCTATAGAAAATGCAGAGAGAAATCATTGTACTCATATTACAGTATATGAAGGTGATGCCACCCTACTTAAAGACAAAACATACAATCTTATTATCGCAAACATTAATAGAAATATCTTATTACAAGATATTCCTACATATGCTTCTTGTCTTTCTGATAATGGGATATTACTATTAAGTGGCTTCTATACCGAAGACATTTCATTAATTACAGAAAAATGCAATGAAAACGGACTTTACTTCGTTGGCGCCTGTGACCATACTGAAGAGCAAGCACATCAATGTTCTTTAATTGTACATTACAAAGGAAAATGTACTGTCAAGACAGGAGATTATGACGATCTCAAACCTAGATGTTCTAAGCTTTTGCAAGCTGGTTTAAGTGCAGAAATTGTATAA

Transcript

ANN32789-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A5FE44	Triosephosphate isomerase OS=Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101) OX=376686 GN=tpiA PE=3 SV=1
A6GZI2	Triosephosphate isomerase OS=Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86) OX=402612 GN=tpiA PE=3 SV=1
Q7MWI7	Triosephosphate isomerase OS=Porphyromonas gingivalis (strain ATCC BAA-308 / W83) OX=242619 GN=tpiA PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002485 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02617 all species →	ClpS	ATP-dependent Clp protease adaptor protein ClpS	Family	Interproscan
PF06325 all species →	PrmA	Ribosomal protein L11 methyltransferase (PrmA)	Family	Interproscan
PF00121 all species →	TIM	Triosephosphate isomerase	Domain	Interproscan
PF00082 all species →	Peptidase_S8	Subtilase family	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR013785 all species →	Homologous_superfamily	Aldolase-type TIM barrel	Interproscan
IPR000652 all species →	Family	Triosephosphate isomerase	Interproscan
IPR020861 all species →	Active_site	Triosephosphate isomerase, active site	Interproscan
IPR003769 all species →	Domain	Adaptor protein ClpS, core	Interproscan
IPR036852 all species →	Homologous_superfamily	Peptidase S8/S53 domain superfamily	Interproscan
IPR029063 all species →	Homologous_superfamily	S-adenosyl-L-methionine-dependent methyltransferase superfamily	Interproscan
IPR014719 all species →	Homologous_superfamily	Ribosomal protein bL12, C-terminal/adaptor protein ClpS-like	Interproscan
IPR000209 all species →	Domain	Peptidase S8/S53 domain	Interproscan
IPR035990 all species →	Homologous_superfamily	Triosephosphate isomerase superfamily	Interproscan
IPR022896 all species →	Family	Triosephosphate isomerase, bacterial/eukaryotic	Interproscan
IPR004498 all species →	Family	Ribosomal protein L11 methyltransferase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR21139 all species →	TRIOSEPHOSPHATE ISOMERASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004807 all species →	Molecular Function	triose-phosphate isomerase activity	Interproscan
GO:0030163 all species →	Biological Process	protein catabolic process	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0006094 all species →	Biological Process	gluconeogenesis	Interproscan
GO:0006096 all species →	Biological Process	glycolytic process	Interproscan
GO:0019563 all species →	Biological Process	glycerol catabolic process	Interproscan
GO:0046166 all species →	Biological Process	glyceraldehyde-3-phosphate biosynthetic process	Interproscan
GO:0004252 all species →	Molecular Function	serine-type endopeptidase activity	Interproscan
GO:0006508 all species →	Biological Process	proteolysis	Interproscan
GO:0008236 all species →	Molecular Function	serine-type peptidase activity	Interproscan
GO:0006479 all species →	Biological Process	protein methylation	Interproscan
GO:0008276 all species →	Molecular Function	protein methyltransferase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for ANN32789-RA.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora grisea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora grisea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →