Gene detail

Detailed information of ANN34151-RA in Montipora grisea

Genomic Location: Scaffold_711__1_contigs__length_78155:29967...32162
NR annotation: NIM29472.1, DNA helicase II [Gammaproteobacteria bacterium]
Species Montipora grisea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN34151-RA

ATGGACGTCACCGACATCCTCGATCCGTTGAACGACGCGCAGCGCGAGGCGGTCACCGCCCCCGCCGGGCACCTGCTCGTACTCGCCGGCGCGGGCAGCGGAAAGACGCGGGTGCTCGTGCATCGCATCGCATGGTTGCTCGCGACCCGCGAGGCGACACCGTTCGGGATCCTCGCGGTGACGTTCACCAACAAGGCCGCGTCGGAGATGCGGTCCCGCATCGAGGCGATGCTCGGCCGGCCGGTGGGCGGGATGTGGGTGGGGACGTTTCACGGTCTCGCGCATCGGCTGCTGCGCGCCCATTGGCAGGATGCGGGCCTGGCGGAAGGCTTTCAGATCCTCGACAGCGACGATCAGCTCCGCTGCATCCGTCGGGTGTTGCGCGATCTCGACCTCGACGAGCAACGCTGGCCGCCCAAGCAGGCCCAGGGGTTCATCAACGCGCGCAAGGACGAAGGGCTCCGCGCCGAGCATCTCGATGATCGCGGCGACTTCTGGATGACCCGCATGCTGCGCACCTATGCGACGTACCAAGAGACCTGCGAGCGCACCGGGGTCGTCGATTTCGCCGAGCTGCTGCTCCGGTGCCACGAGCTGTTTCGCGACCGCGAGGACGTGCTCGCGCACTATCGCGAGCGCTTCCGCCACATCCTGGTCGACGAATTCCAGGACACCAACACCATCCAGTACGCGTGGCTCAGGCTGCTTGCGGGAAGCGAAGGCTGCCTGTGCTGTGTCGGTGACGACGATCAGTCGGTCTACGGCTGGCGAGGCGCTCGCATCGAGAACATCCTGCAGTTCCCCCGGGACTTCGCGGGCGTCGCCACGGTGCGCCTCGAACGCAACTACCGATCGAGCGGCAACATCCTCGCCGCCGCGAACGCTCTCATCGCCAACAACCAGGGGCGGATGGGAAAGAACCTCTGGACCGAGGACGGCGACGGAGAGCCGATCGAAGTCTACGCGGGGTTCAACGACATCGAAGAGGCGCGGTTCATCGTGTCGCGCATCCTGCAATGGATCGAATCGGGTGGCCGCCGCGAGGAGGTCGCGATTCTGTATCGGGTCAGCGCCCAGTCACGTGTGCTGGAAGAGGCGCTGCTTTCGCAGGGTGTCGCTTATCGGGTCTACGGCGGCCTTCGCTTCTACGAACGCGCCGAGATCAAGAATGCCCTCGCCTACTGCCGCCTCGTCGCGAATCGCGACGACGATGCCGCGTTCGAACGGGTCGTCAATCTGCCGCCACGGGGGATCGGCGCGCGTACGGTGGACACGTTGCGCACCGAAGCGAAGCAACGGGGAGAGTCGCTGTGGGTGGCAGCGCGAAGGGTCGTCGCCGAAGGCATGGTGGGCGCCCGCGCGGCGGGCGCGTTGGGAGGCTTCCTCGGGCTGGTCGATGAGCTTGGGAACGGCTTCCAGGACATGCCGTTGCAGGAACAGGTCGAGACGGCCGTGGAGCGCAGCGGCCTGTTCGAGTATTACAAGCGGGAGAAGGTCGATCGTGCTCGGACGCGGATCGAGAACCTCCAGGAGCTCGTGGTCGCGGCGGGTCAGTTCGCCGTCGGCGGTGAGGACCACGACTCGCAGGACCCTCTGAATGTGTTCCTCTCCCATGCCGCCCTCGAGGCCGGCGAGGAACAGGCAGCGGATGGGGAGGATCTGGTCAGCCTGATGACCCTGCATTCGGCGAAGGGGCTGGAATTCCCCGTGATCTTTCTCTGCGGGATGGAAGAGGGGCTCTTCCCGCACAGCCGCAGCAGCGAGGATCCGGGAAAGCTCGAGGAGGAGCGGCGGCTCTGCTACGTGGGAATGACTCGTGCGAAACGCAAGCTCTGCATGTCCTACGCGGAGTCGCGGCGGCTGTACGGGGGGGGCTCCGACCGGTATTCGACGCCGTCGCGCTTCCTGCGGGAGCTGCCGCCCGAACGCATCGAAGAAGTCCGCCTGCGGGGGGCGGTGTCACGGCTCGGCCCGCGGGTTTCACCCAAGCGTCGGGCCGGCCGGGAGTCGCTCGACGGCGGATCGAACGGATTGCGTCTCGGACAGCGGGTCCAGCACCCGAAGTTCGGTGAGGGGGTGGTGTTGATGTACGAAGGACAGGGAGCCCACGCCCGGGTGCAGGTCAACTTCGAGGCGGCCGGCAGCAAGTGGCTGGTCGTCGCCTACGCGAACCTGGTCCCGATCGGAGCCCGGTGA

Transcript

ANN34151-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P03018	DNA helicase II OS=Escherichia coli (strain K12) OX=83333 GN=uvrD PE=1 SV=1
Q05311	DNA helicase II OS=Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720) OX=99287 GN=uvrD PE=3 SV=2
Q02322	DNA helicase II OS=Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd) OX=71421 GN=uvrD PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0011520 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13361 all species →	UvrD_C	UvrD-like helicase C-terminal domain	Domain	Interproscan
PF21196 all species →	PcrA_UvrD_tudor	PcrA/UvrD tudor domain	Domain	Interproscan
PF00580 all species →	UvrD-helicase	UvrD/REP helicase N-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR013986 all species →	Homologous_superfamily	DExx box DNA helicase domain superfamily	Interproscan
IPR014016 all species →	Domain	UvrD-like helicase, ATP-binding domain	Interproscan
IPR014017 all species →	Domain	UvrD-like DNA helicase, C-terminal	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR000212 all species →	Family	DNA helicase, UvrD/REP type	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11070 all species →	UVRD / RECB / PCRA DNA HELICASE FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0016787 all species →	Molecular Function	hydrolase activity	Interproscan
GO:0000725 all species →	Biological Process	recombinational repair	Interproscan
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0003678 all species →	Molecular Function	DNA helicase activity	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0033202 all species →	Cellular Component	DNA helicase complex	Interproscan
GO:0043138 all species →	Molecular Function	3'-5' DNA helicase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K03657	uvrD, pcrA; ATP-dependent DNA helicase UvrD/PcrA	EC:5.6.2.4	DNA repair and recombination proteins	ko03400	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora grisea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora grisea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →