Gene detail

Detailed information of ANN34923-RA in Montipora grisea

Genomic Location: Scaffold_2920__1_contigs__length_39202:12782...15169
NR annotation: MCK5284869.1, DEAD/DEAH box helicase [Alphaproteobacteria bacterium]
Species Montipora grisea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN34923-RA

ATGAATAGCTTTGAAAGCTTTGGTCTCTCACAGACGCTGAACGCGTCTCTGGCGAGAATTAATTATAAAACCCCAACCTCTATTCAAGCCCAAGCGATACCACTCGCCCTTAGAGGTCGAGATATTCTGGGTAGTGCGCAAACAGGAACCGGTAAGACAGCGGCATTTAGTATTCCGCTTGTTGAATCACTTCTGCGCTCTCCTCATGGCTGCGCTCTTATTTTAACGCCGACACGTGAGCTCGCTAAACAGGTTTTAGGCGTGATCCATGATTTGCTTGGCCGTAACAGCGACATCAACACAGCCTTTATTATTGGTGGTGAGGCGTATGGTAAACAAATGTCACAATTGCGCGCTAACCCTCGCGTTATTGTCGGCACACCGGGGCGGATCAATGACCATTTGGAGCGCGGCTCCATCAAACTGGATAAGACGAGTTTTCTGGTTCTTGATGAAACAGACCGCATGTTGGATATGGGTTTTGGTGTGCAACTCGATAAGATCATCAAATTTCTGCCTGAAAACCGTCAAACATTGATGTTTTCTGCGACATTGCCTAAAGGCATCATCGCGCTTTCAAGCAAATATATGAATAATCCGCACCGCATATCGGTTGGTGAAACCAATGTCATTGCGAGCAATATCAAGCAAGAAGCGATGCGCATCGAGCAGGCGGATAAATATCAAGAACTGGTCGTTCAGCTCCATGCGCGCCAAGGCTCAGTGATCGTGTTTGTTAAGACAAAGTACAATGCTGATAAAATGGCCAAAAAACTACGTCAGGAAGGTTTTACTTCAGAAGGTCTCCATGGCGATTTACGGCAAAATAAACGTGACAAGGTAATGAAGAATTTTCATTCCCAGAACTTCAGGGTTTTGATCGCGACTGATATTGCTGCGCGCGGCCTTGATGTCCCGCATATCGAACATGTAATCAATTATGATCTTCCGCAAGTCGCAGAAGATTACATTCACCGAATGGGCCGAACAGCACGCGCTGGTGCGAAGGGCTCAGCGCTGAGCTTTATTTCTGCGCAGGATGGTCGCAAATGGCATGCGATTGAAAAACTGCTAAACCCTGAAGCCGCCAATGATTACCAAGATGGACCAAAACGTAAAAATAAAGCGCGCCGCAAGCCTTATCGTGGACGCCCACAGCCTGATGAACAATCGTCCAAAAATCATGGCGAAAAGCGACGCAACAAACATTCTAAACGTCCTGACAAAAATGAAAGTAAGCGTAAAAATAATCGTAAGCACAATGACGGGCAGCAAGAGCATGATAGTCGCGGGGAAAGACCGGCTAAAAAGCACCAAAAAAACAGCAAGCATAATACGGCAGAGAAATTCGTTCAGCCCCGCAAGCCTGCAGACAAAAAGCATAAATCTCGAGGCAAAAAAACCAACGGAGTTGACTGGTCAGTCAAATGCGATATATCTGTTGCAGAGAAAGTTATGGCAGTGCAACAAGAAACGCAAAAAACACCGACAAAAGAACGGCTTATCGAAACCGCGATCGATTTGATCTGGAAATCGAGTTATGGCGCCGTCAGCGTGGACGGCATTTGTAAAGAAGCCGATGTTCGAAAAGGGAGCTTCTATCATTACTTTCCATCGAAGATAGATCTGGCTGTTGCGGCCATGGATTCCGCGTATTCCGAATTTAAATGCATGATGGAAGAAATGTTCGATAAATCCGTGCCGCCGGTCGAACGATTTGAACGCCTCATGGAGTATGGCTTGGCGCATCAGGAAGAAGTCGCTGAAAAATACGGACGTGTGTGCGGCTGTCCTTTCATCAGTCTGGCGAGTGAAATGGCACCACAAGACCCGCAAATCCGGGAAAAAGTGGAAGGCATTATCATGAGAAAGCGCAGTTTTTATGAGGGTGCACTTGAGGACATGATTACCGAAGGGCTGATACCCGAAGATACTGACGTCGAGGCGATGTCATACAAAATTTATACTTTTGTTATGGGACAGTTGATGCTCGCCCGTATACAAAATAGCTTGGAGCCGATGAAGCGCGATTTAAGAACAGGGTTATTCGCGCTTATTGGCATTGATTATTCCGCGTTGAAGCGATCTGCGTAA

Transcript

ANN34923-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P25888	ATP-dependent RNA helicase RhlE OS=Escherichia coli (strain K12) OX=83333 GN=rhlE PE=1 SV=3
Q65N62	DEAD-box ATP-dependent RNA helicase CshA OS=Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46) OX=279010 GN=cshA PE=3 SV=1
Q5L3G9	DEAD-box ATP-dependent RNA helicase CshA OS=Geobacillus kaustophilus (strain HTA426) OX=235909 GN=cshA PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003636 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00440 all species →	TetR_N	Bacterial regulatory proteins, tetR family	Domain	Interproscan
PF00271 all species →	Helicase_C	Helicase conserved C-terminal domain	Domain	Interproscan
PF00270 all species →	DEAD	DEAD/DEAH box helicase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR014001 all species →	Domain	Helicase superfamily 1/2, ATP-binding domain	Interproscan
IPR001647 all species →	Domain	DNA-binding HTH domain, TetR-type	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR001650 all species →	Domain	Helicase, C-terminal domain-like	Interproscan
IPR050079 all species →	Family	DEAD box RNA helicase	Interproscan
IPR036271 all species →	Homologous_superfamily	Tetracyclin repressor-like, C-terminal domain superfamily	Interproscan
IPR009057 all species →	Homologous_superfamily	Homeobox-like domain superfamily	Interproscan
IPR014014 all species →	Domain	RNA helicase, DEAD-box type, Q motif	Interproscan
IPR011545 all species →	Domain	DEAD/DEAH box helicase domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR47959 all species →	ATP-DEPENDENT RNA HELICASE RHLE-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0003724 all species →	Molecular Function	RNA helicase activity	Interproscan
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for ANN34923-RA.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora grisea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora grisea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →