Gene detail

Detailed information of ANN35428-RA in Leptoseris scabra

Genomic Location: Scaffold_1929__1_contigs__length_23769:6890...9667
NR annotation: VFT17146.1, methylcrotonyl-CoA carboxylase subunit beta [Pseudomonas aeruginosa]
Species Leptoseris scabra · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN35428-RA

ATGTTTGAATACCAAAGTACACAGTTCTACACCCTAGATGAACCCATGCGCCTTTTGGAAGAGCAAGCGACGCGTTTTGCTCGCCAAGAAATTGCGCCTATTGCGGCATCAATCGATAGCAATAACAGTTTCCCGCTAGACCTATGGAATAAAATGGGTGAAATGGGGTTTCTAGGCATTACTGCGCCAGAAACCTATGGCGGCGCTCAACTTGGTTATAAAGCTCACGCCCTGGTCATGAAAATTATTAGTCGAGCCAGTGCCAGTGTCGGCTTAAGTTATGGTGCTCACTCAAATCTCTGTGTGAATCAACTCTGTCTTAACGGTAATGAAGCGCAAAAACAGCGCTATCTTCCCGATCTCATCAGTGGTAAATCCGTCGGCGCTCTAGCGATGAGTGAAGTCCAATCAGGTTCAGATGTCGTGAGCATGAGTCTCAGGGCGGACCCTGCACCTGGAGGCTATCGTTTAACGGGTAACAAGATGTGGATTACTAATGGGCCTGATGCCGATGTCTTAGTGGTTTACGCCAAAACAGAACCAGATGCTCACCAGCACGGTATCACCGCATTTATTGTTGAAAAAAGTTTTCCTGGATTTTCCCAAGGTGAAAAACTCGACAAATTAGGCATGCGTGGCTCAAACACTTGCGAACTGATCTTTGATGATTGCTTTATTCCTGAAGAAAATATTCTTGGCAATCTAAACGCTGGGGTTAAAGTGCTAATGAGTGGTCTCGATTATGAGCGACTCGTGCTAGCAGGAGGCCCGGTGGGTATCATGGAAGCCTGCCTTGATACCGTGTTGCCTTATATTCACAGTCGCGAACAGTTTCGCCAACCTATTGGTGAATTTCAACTGATTCAAGGTAAGGTGGCGGATATGTGGACCCACTATCAAGCGGCAAACACCTTACTCTTTCAAGTGGCAGAACAATACGATCAGGGATTGGGCGATAGAAAATCGGCAGCCTCTGTCATTCTTCTCTGTGCCGAAACAGCGACTCGGCTAGCGTTAGACTGTATTCAAATTCTCGGCGGTAATGGCTACACCAACGATTATCCAGCCGCACGTCTTCTTCGAGATGCCAAACTTTATGAGATTGGGGCAGAAACCTTTTTGGGCGGTGGCGAAAAAGCCATTGCTCGCCTGGCTAAGCAAGGAAAATGGACCGCTCGCCAGCGAATCGATGCCTTACTCGATCCCGCCTCTCCCTTTTTAGAGATTGGGCAATTTGCAGGTTGGGAGGTTTACCCTGAGAAAACGCCAGCCGCAGGCATTGTCATGGGCATTGGCTATGTGGCGAATCGTCTCGTTATGATTATCGCCAACGACGCGACGGTAAAAGGCGGCAGTTATTTCCCGATGACAGTTAAAAAACACTTACGGGGCCAAAAAATTGCCGAGGATTGTCGTTTACCCTGTATTTATTTAGTGGATTCCGCCGGTGCCAATCTGCAACGCCAAGCGGAAGTTTTCCCTGATCATGATCACTTTGGCCGAATCTTCTTTAACCAAGCGCGACTCTCTGCCGCAGGCATGACGCAAATTGCCGTCGTGATGGGAAGCTGTACCGCAGGTGGTGCCTACATTCCCGCAATGGCGGATCAAACTATTATTGTCGAAGAAACAGGAACTATTTACTTAGCAGGCCCTCCTTTAGTCAAGGCCGCCACTGGTGAAGTGGTAGATGCTCAAACCTTAGGGGGGGCAACATTACACACAGAGTCTTCTGGTGTGGCTGATTATCGAGCGAAAGATGATGCCGACGCCATTGACATTGCTCGTCGATGTGTCAGTCATTTAGAGGCAGAACAGCGTCCACCTTGGCCTCAGGACACGGTATCCTTAGCACCAGCTGTCGACTTTTCTGATATGGAACAATGGCTGCCAGATAACCCAAAACAAACCTATGATATCCGTGAAGTTCTCTATCGCTTTGTTGATCGCTCCGAGCTAGAAGAATTTAAACCCGCTTTTGGTCCTCGTCTCGTGTGTGCCTTCGCCACAATTATGGGACAACCTGTCGGCATTATTGCTAACCAATCTGTCTTGGATTCACAAACGGCGCTTAAAGCCGCCCATTTCATCCAACTTTGCTGCCAACGTAATACGCCTTTGTTATTTGTCCATAACGTTTCGGGATTTATGGTCGGCCAGCAGTACGAAGCCGAAGGTATTGCAAAACAAGGGGCCAAAATGGTGAATGCTGTCAGTTGCGCCACGGTACCGAAAATTTCCCTGATTGTTGGTGGTAGCTATGGCGCAGGAAACTATGCCATGTGCGGTCGTGCATACGATCCAGACTTTGTTTGGGCCTGGCCGACAGCTCGCACGGCGGTTATGGGTGGAGAACAAGCTGCTGACGTCGTCATGCAATTAGCCGCCAAAAAAAGCCAAAGTCCTAGCCCTGATGTGGAAGCCATTAAGGCAAGATTTGAAGAAGAAAGTCAGCCTTACTACTCCAGTGGCCGTCTCTGGGATGACGGCATCATTACCCCCGAAGAAACACGTTTAACGTTGGCCTTAAGCCTTTATGCAGCAAGGCATCCTAAACGACTGCAAGAGGCCAACACCCAATTCGCTGTCTTTCGTATGTAG

Transcript

ANN35428-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5XIT9	Methylcrotonoyl-CoA carboxylase beta chain, mitochondrial OS=Rattus norvegicus OX=10116 GN=Mccc2 PE=2 SV=1
Q3ULD5	Methylcrotonoyl-CoA carboxylase beta chain, mitochondrial OS=Mus musculus OX=10090 GN=Mccc2 PE=1 SV=1
Q9HCC0	Methylcrotonoyl-CoA carboxylase beta chain, mitochondrial OS=Homo sapiens OX=9606 GN=MCCC2 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001327 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02771 all species →	Acyl-CoA_dh_N	Acyl-CoA dehydrogenase, N-terminal domain	Domain	Interproscan
PF00441 all species →	Acyl-CoA_dh_1	Acyl-CoA dehydrogenase, C-terminal domain	Domain	Interproscan
PF01039 all species →	Carboxyl_trans	Carboxyl transferase domain	Family	Interproscan
PF02770 all species →	Acyl-CoA_dh_M	Acyl-CoA dehydrogenase, middle domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR037069 all species →	Homologous_superfamily	Acyl-CoA dehydrogenase/oxidase, N-terminal domain superfamily	Interproscan
IPR009100 all species →	Homologous_superfamily	Acyl-CoA dehydrogenase/oxidase, N-terminal and middle domain superfamily	Interproscan
IPR006089 all species →	Conserved_site	Acyl-CoA dehydrogenase, conserved site	Interproscan
IPR046373 all species →	Homologous_superfamily	Acyl-CoA oxidase/dehydrogenase, middle domain superfamily	Interproscan
IPR013786 all species →	Domain	Acyl-CoA dehydrogenase/oxidase, N-terminal	Interproscan
IPR011762 all species →	Domain	Acetyl-coenzyme A carboxyltransferase, N-terminal	Interproscan
IPR011763 all species →	Domain	Acetyl-coenzyme A carboxyltransferase, C-terminal	Interproscan
IPR009075 all species →	Domain	Acyl-CoA dehydrogenase/oxidase, C-terminal	Interproscan
IPR045190 all species →	Family	Methylcrotonoyl-CoA carboxylase beta chain MCCB/AccD1-like	Interproscan
IPR036250 all species →	Homologous_superfamily	Acyl-CoA dehydrogenase-like, C-terminal	Interproscan
IPR029045 all species →	Homologous_superfamily	ClpP/crotonase-like domain superfamily	Interproscan
IPR034733 all species →	Domain	Acetyl-coenzyme A carboxylase carboxyl transferase subunit beta	Interproscan
IPR006091 all species →	Domain	Acyl-CoA oxidase/dehydrogenase, middle domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR22855 all species →	ACETYL, PROPIONYL, PYRUVATE, AND GLUTACONYL CARBOXYLASE-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016627 all species →	Molecular Function	oxidoreductase activity, acting on the CH-CH group of donors	Interproscan
GO:0050660 all species →	Molecular Function	flavin adenine dinucleotide binding	Interproscan
GO:0003995 all species →	Molecular Function	acyl-CoA dehydrogenase activity	Interproscan
GO:0016874 all species →	Molecular Function	ligase activity	Interproscan
GO:0004485 all species →	Molecular Function	methylcrotonoyl-CoA carboxylase activity	Interproscan
GO:0006552 all species →	Biological Process	L-leucine catabolic process	Interproscan
GO:1905202 all species →	Cellular Component	methylcrotonoyl-CoA carboxylase complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01969	MCCC2, accD1; 3-methylcrotonyl-CoA carboxylase beta subunit	EC:6.4.1.4	Valine, leucine and isoleucine degradation	ko00280	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Leptoseris scabra tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Leptoseris scabra, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →