Gene detail

Detailed information of ANN36428-RA in Montipora grisea

Genomic Location: Scaffold_9636__1_contigs__length_17826:6461...9193
NR annotation: RKU09833.1, sulfatase [Candidatus Poribacteria bacterium]
Species Montipora grisea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN36428-RA

ATGGGAGCAACACACTATTCTTTACCATTACCTTCAACAACTCACACTAAACAATTCAGTACACCCAAAATTGATCCGTCTAAAATACGCGTGGTCATCCCAGTCTATAAAGATTGGGAAGGACTCAAAATTACTTTGGATAGTCTTCATGCCTTGAATCCTCGTCCGGGGACTATTACTGTCGCAAATGATAATGATGATAATCACCTGCCGACATGGTTAAAATCATATTCTGTACAAATAATCAATTATCGCGGTAACCAAGGACCCGCGTTTGCAAGAAATAATGGTGTTGGAAATCCAGACAGCAACTTTGATTGGGTATATTTTACTGATTGCGGATGTGAACATACCAGAGATATTATCATGCAATTCATGGACGCACAAAAAACAGATGATGATTCAATAGTTGCTGTGTGTGGTAATGTTGCTGGCAAAGGTTCGGGAAAAATAAATCGGTATATGACTGAAATGAAAATACTCAATCCACCTTTTGAGGAAGATTTGGGTCCGCATGGAGAACAAATTCCGCAAGCAATTATCACTGCAAATGTTCTCATATATGCACCTGCCTTCCATCAATTAGGTGGATTTTCGACTGCTTTTGCTGGGGCAGGAGGTGAAGATTTAGATTTAGGTATAAGGCTTAGAAAACTCGGAAGATTAGTTTTCGCACCGAATGCAACTGTCTATCATGAATTTGATGAAGATATCCAAGATTTCATACGCCGTTTTGAGCGATACGAGTACAATCTTGTCAAAACAGGAGTCAGAATGAACAGAACAGACCGCCCAAACATCCTCTGGATCTCCTTAGAGGATACAACACCACGTTTCGGTTGCTATGGTGACCCAATCGCTCGTACCCCGAATATTGACCGCCTCGCAGCAGGCGGATGTCGGTTTCCGAATGCCTTTTCAACAGCAGGCGTTTGTGCCCCCAGTCGTTCCGCTATCATCACCGGTATGTATCAGACCTCCATTGGGACACATCACATGCGGACGGGGCATACAAACCGCAATACACCGGACATGCCAACGCCGTATTCTGCTGTTCCACCACCCTACGTCAAAACTTTTACAGAATATCTAAGGGCTGCAGGCTATTACTGCACTAACAATAGCAAGACCGACTATCAGTTTACGCCACCTATCACTGCCTGGGATGACAATAGCAACCAAGGGCACTGGCGAAATCGTGAGAACGGACAATCCTTTTTTTCCGTCTTTAATCCTACTGTTACTCATGAAAGCGGCATGTGGGAGAAACCTGATCGTCCGTTGACCACGACGACCAACCCAGATGACGTAGAATTACCTCCTTATCTACCCGATACGCCAAAAGCAAGACAGGCATTGGCTCGTCAGTATGACAACCTTGCTACTGCTGACGCACGTGTAGGTGAGTTGTTAGACCAATTGGAAGAGGATGGACTTTATGATAACACGATTGTCTTTCTCTGGAGTGATCACGGTGAAGGATTGCCACGAGGTAAACGATGGCCTTATGATGCTGGCATACGCATTCCTCTGATTCATAAAGTTATTGATCCTGACAGCACATCTGATCAATTGGTAAGTTTGATTGACCTCGGACCAACTGTGCTTTCGTTATGTGGCGTGCAAGCACCGCAGCACTTACAAGGACAACCCTTCCTCGGACCGCAAACAGTTGAGCGGGATTATATCTTTGCAACACGCGACCGATACGATGAATCTTATGATATGATACGTGCCGTGCGGGATAAAAAGTATAAATACATCCGAAATTATTATCCCGAAAAACCTTATCTTCTCTGGATTCCTTATCGCAACCGTCACCCCGTGATGCAGGAGATGTGGCGGCTGTATGCTCAAGGTAAGTTAGAAGGGGACAAATTGGTCATGTTCCAATCACCGCGCCCCACAGAGGAACTCTACGATGTGGAAAATGACAAGTTTGAACTCAACAACTTAGCAGAAGATACAGAGCATGCAAATGTGCTCGATCGAATGCGAAATGCTTTGTTAGAGTGGCAATCTGAATTTGGAGATATGGGAGATATATCTGAAGAGCAGATGGTCGCAAGATGGTATCCTAACGGCACACAACCACAAACGGCATCGCCAATTTTTATTCCCATCAATTCATCAAATCCCGGTAGAGAACCCACTGAAGGGGATGGTGAATGGAAAGCCCCACTGCTTTTGCAGCTCCACTGTTCTACACAAGGTGCATCAATTGCCTATACAACGGAACAGGGTGAAGATGTCCAATGGAAATTGTATACAGAACCTTTGCGTTTACCGAAAGGCGAAACCACTGTCAGAGCAAAAGCAATTCGGATCGGTTATAAAGAGAGTGATGAGAACATCCTTCACGCAAAAATCTTATAG

Transcript

ANN36428-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
T2KN90	Ulvan-active sulfatase OS=Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1) OX=1347342 GN=BN863_22210 PE=1 SV=1
Q21376	Putative extracellular sulfatase Sulf-1 homolog OS=Caenorhabditis elegans OX=6239 GN=sul-1 PE=3 SV=1
Q32KH0	Arylsulfatase K OS=Canis lupus familiaris OX=9615 GN=ARSK PE=2 SV=1

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13632 all species →	Glyco_trans_2_3	Glycosyl transferase family group 2	Domain	Interproscan
PF00884 all species →	Sulfatase	Sulfatase	Family	Interproscan
PF00535 all species →	Glycos_transf_2	Glycosyl transferase family 2	Family	Interproscan
PF13290 all species →	CHB_HEX_C_1	Chitobiase/beta-hexosaminidase C-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001173 all species →	Domain	Glycosyltransferase 2-like	Interproscan
IPR000917 all species →	Domain	Sulfatase, N-terminal	Interproscan
IPR024607 all species →	Conserved_site	Sulfatase, conserved site	Interproscan
IPR029044 all species →	Homologous_superfamily	Nucleotide-diphospho-sugar transferases	Interproscan
IPR017850 all species →	Homologous_superfamily	Alkaline-phosphatase-like, core domain superfamily	Interproscan
IPR050738 all species →	Family	Sulfatase enzyme	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR42693 all species →	ARYLSULFATASE FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004065 all species →	Molecular Function	arylsulfatase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for ANN36428-RA.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora grisea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora grisea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →