Gene detail

Detailed information of ANN36492-RA in Montipora grisea

Genomic Location: Scaffold_8102__1_contigs__length_23366:10057...13184
NR annotation: RKU13163.1, phenylalanine--tRNA ligase subunit beta [Candidatus Poribacteria bacterium]
Species Montipora grisea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN36492-RA

ATGAACGTAACCCAAAATTGGCTAAAAACCTACATCAATTTTGATTTTTCCCCAGACGAACTCGCTGATAGATTAACGATGTTAGGCATTGAAGTTGAATCTGTCAAACAACTCGGCGCGGCATTGGAAGGCGTAGTTGTCGGTAAAGTAACTTCCATCAAACCACATCCGAATGCAGATAAACTTGTGCTGTGTCAGGTAGATATTGGTGAGACGAATGCGCTGCAGATCGTTTGCGGTGCACCAAATGTTTATGAAGACATGTTCGCGCCTGTCGCAACGGTCGGTACAGAATTGCCAACCGGTATTACAATCAAGCGCGCTAAACTACGCGGCGAAGAATCGCACGGCATGCTCTGCTCTGAAAAAGAATTAGGCATCTCTGATGAAGCTGCGGGACTTATGGAATTGTCCTCAGACCTATCCATAGGTTCACCACTCACCGAAGCATTAGGATTAGACGATACGGTATTTGAGTTGGAGATAACACCAAACCGTCCAGATTGTCTCAGTATGATAGGCGTTGCCCGTGAAATTCGCGCTGAAACAGGTAACGACTTAAAACTCCCACAAGTTAACCTACAAGAAGGTGAGGCAGATATAAATGAACTTACATCTGTAACGATTGATGCTCCCGACCTGTGTCCCCGTTATGCAGCGCGTGTTATCCGTGGTGTTAAAATCGGTGAATCTCCGGCGTGGTTAAAACAGCGGCTTGAATCTATCGGGGTCGGTGTTATCAATAATATAGTAGATATTACAAACTTTGTTTTGATGGAATGTGGACAACCGCTGCACGCCTTTGATTATCACAAACTTGCTGAAAATCGTATTGTCGTGCGTCGTGCAGCAGAAGGAGAACAGATCACAACACTTGATGAAGAGGAACGCAAACTTACTCCCGATATGTTAGTTATCGCAGATGCCGAAAAGCCTGTGGCACTTGCTGGAATTATGGGTGGCTATGACTCTGAGATCACCGAAACAACATGTGACGTGCTGCTGGAAAGCGCCAATTTCCAACCGTCAAGCGTTCGTGCAACTGCGAAAAAGCTGGGAATAAATACGGAGGCTTCCTACAGATTTGAACGTGGCGCGGATCCGGAGGCTGTAATTCCTGCGCTCGACCGCGCAGCGCAACTGATCGCGGAATTAGCAGGCGGCACTATCTGTGGAGGCATTATTGATGTTTATCCCCGACAATGTGAACCGCTGCAAATTCAACTCCGTGCCGAACGCGTTAATTTCATATTGGGAACCGAACTTGAAGCAGATGAAATAGTCCAGATTTTAAGTCGATTGGGATTTGGCATAGAAGCATCACAATCAGGAGAAAATATGTATCAAATCACCGTGCCATCGTTCCGCGGGGATATTGCACGCGAAATAGATTTGATAGAAGAAATTGCGCGTGTCCACGGTTATGATAACATTCCAACAGCATTACCAAAAGGTGACATCCCTATTCCCCCGCCAAACATATCAGTAGAGGTGCGTAAACGTATAAAGCATTTTCTACTTGGCTCTGGCATGATGGAGACAGTAAACTATAGTTTCAGCCACCCAAACTGCTTTGACAAGATAGGATTAGCAGCAGACAATCCACTTCGCCAAGCACTACAACTGAAAAACCCGTTGAGTCCAGAGATGTCAATTCTACGCACAACGTTGCTGCCGAGTTTGCTTGATAATGCACAACACAACCACAATCATCAGATAAATAATATCGCACTCTTTGAGATGTCCACAGTGTTCATCCAAGCAGAGGAACCGGCGCGGGTTGCTGGTATTCTCGCAGGAGAAATTGGCGAAGGTGTTTACGGTAATCCCCATCGTTCTCCAGACTTCTTTGATATTAAAGGGACTGTTGAAGGTGTGCTTGACATCTGTGGGACTACCGATTATACGTTCAAGAAAACAGACGACCCAACCTTCCACCCGGGGCGTAATGCTGAGGTGTTGTTAGAAGGAAAACGCATCGCCTTCGGTTTTGATCGCGTATGGAGACGAGAGACAGTCAAAGCAAGTCGTGTAACCCCAACAAGCAAGGTGCTTGATGTTTGCACAGGCACAGGAGAACTCGCTTTGGCGTATGCCGACAAAATTGACACAAGCGGTTCTGTCATCGGTTCAGATTTCTGCTTTGAGATGTTGGTTGTTGGTAAGCAAAAAGTGGAACGGCAGGGAAGGACACACGCCTTTGTACCGATTGAGGCGGATACCCTTACGCTACCGTTTGAGGATAATACTTTTGATATTGTCTCTGTCGGTTTTGGCATCCGAAATGTTACTGATCTTGAAAAGGGTATCCGAGAGATGGCACGCGTTGCAGTGCCGGGCGGTAGAATAGCAATCTTAGAGTTTACGCAACCTGTCAATCCGATATTTCGTAGCCTCTACTATTTCTATTTCACAAAGATTTTACCTTTCATCGGCAATCGCATCTCGCGCAGCAAAGATGATGCTTATGGCTATCTTCCCCGTTCAGTCATGCAGTTCCCAAATTGTGATGCATTGAAAGCAGTTATGGAGCAGTGTGGACTAACAGATGTGCAGTATTATCGGAAAACTTTGGGTATCGTGGCAATTCATGTTGGTATAAAAGCATAG

Transcript

ANN36492-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q2LR26	Phenylalanine--tRNA ligase beta subunit OS=Syntrophus aciditrophicus (strain SB) OX=56780 GN=pheT PE=3 SV=1
Q39VS4	Phenylalanine--tRNA ligase beta subunit OS=Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15) OX=269799 GN=pheT PE=3 SV=1
Q3A4N8	Phenylalanine--tRNA ligase beta subunit OS=Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1) OX=338963 GN=pheT PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0015731 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01588 all species →	tRNA_bind	Putative tRNA binding domain	Domain	Interproscan
PF03483 all species →	B3_4	B3/4 domain	Domain	Interproscan
PF01209 all species →	Ubie_methyltran	ubiE/COQ5 methyltransferase family	Family	Interproscan
PF17759 all species →	tRNA_synthFbeta	Phenylalanyl tRNA synthetase beta chain CLM domain	Domain	Interproscan
PF03484 all species →	B5	tRNA synthetase B5 domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR029063 all species →	Homologous_superfamily	S-adenosyl-L-methionine-dependent methyltransferase superfamily	Interproscan
IPR012340 all species →	Homologous_superfamily	Nucleic acid-binding, OB-fold	Interproscan
IPR002547 all species →	Domain	tRNA-binding domain	Interproscan
IPR020825 all species →	Homologous_superfamily	Phenylalanyl-tRNA synthetase-like, B3/B4	Interproscan
IPR004033 all species →	Family	UbiE/COQ5 methyltransferase	Interproscan
IPR005146 all species →	Domain	B3/B4 tRNA-binding domain	Interproscan
IPR045060 all species →	Family	Phenylalanine-tRNA ligase, class IIc, beta subunit	Interproscan
IPR045864 all species →	Homologous_superfamily	Class II Aminoacyl-tRNA synthetase/Biotinyl protein ligase (BPL) and lipoyl protein ligase (LPL)	Interproscan
IPR005147 all species →	Domain	tRNA synthetase, B5-domain	Interproscan
IPR004532 all species →	Family	Phenylalanine-tRNA ligase, class IIc, beta subunit, bacterial type	Interproscan
IPR041616 all species →	Domain	Phenylalanyl tRNA synthetase beta chain, core domain	Interproscan
IPR009061 all species →	Homologous_superfamily	Putative DNA-binding domain superfamily	Interproscan
IPR033714 all species →	Domain	Phenylalanly tRNA synthetase, tRNA-binding-domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10947 all species →	PHENYLALANYL-TRNA SYNTHETASE BETA CHAIN AND LEUCINE-RICH REPEAT-CONTAINING PROTEIN 47	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000049 all species →	Molecular Function	tRNA binding	Interproscan
GO:0008168 all species →	Molecular Function	methyltransferase activity	Interproscan
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0004826 all species →	Molecular Function	phenylalanine-tRNA ligase activity	Interproscan
GO:0006432 all species →	Biological Process	phenylalanyl-tRNA aminoacylation	Interproscan
GO:0009328 all species →	Cellular Component	phenylalanine-tRNA ligase complex	Interproscan
GO:0000287 all species →	Molecular Function	magnesium ion binding	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01890	FARSB, pheT; phenylalanyl-tRNA synthetase beta chain	EC:6.1.1.20	Transfer RNA biogenesis	ko03016	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora grisea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora grisea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →