Gene detail

Detailed information of ANN36710-RA in Montipora grisea

Genomic Location: Scaffold_4527__1_contigs__length_31971:1409...4170
NR annotation: WP_097458564.1, acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha [Mangrovitalea sediminis]
Species Montipora grisea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN36710-RA

ATGAAAGCGGCTCGAGACAAGGGCATTTACACGGTCGCGGTATACTCTGAGGCTGACATTAACGCCGCTCATGTTCATGCGGCAGATGAAGCCATTGCCATTGGTCCTTCGGCGGCAAAGGCCTCGTATCTTAATATTGAACATATTATCAACGCCGCAAAACGTACCGGCGCCGATGCTATTCACCCAGGTTACGGGTTTCTGTCGGAAAACGCGGCTTTTGCCCAGGCATGTCAAGACGCAGGCGTAACTTTTGTTGGTCCAAGCGCAAAAGCCATTGATTTAATGGGTAACAAAAGACAAGCCAAAAAAGCAGCCGCTCAGGCAGATGTCCCTACGATTCCTGGCTTTCAAAGTGACAGCCAAGATGTCGAACAGTTGCTTGAAGCTGCCGACAACATTGGTTTTCCCGTCATGATTAAAGCGGCACTAGGTGGCGGCGGCCGAGGTCTGCGGGTTGTTGAAAAGAAAGAGGAATTTTCTGCAGCTCTAGAATCGGCCTTGCAGGAAGCTAAAAATGCCTTTGCGGATAGCGAAGTCATTCTAGAAAAAGTTATCCACCAAGCCAAACACGTTGAGATTCAGGTTGCAGCCGACCTTCATGGTCACGTCGTCCATTTAGGTGAAAGGGATTGTTCTTTACAGAGGCGTCGGCAAAAAGTGATCGAAGAATCTCCCTGCCCGACGATTAGCCCAGAGACTCGGGAAGCTATGGGTAAAGCGGCCGTCTCATTGACCAAAGCCTGTGACTACCATGGTGTGGGAACAGTGGAGTTCTTATTGTCAGACAATGGCGATTTTTATTTTCTAGAAATGAATACACGGTTACAAGTAGAGCATCCCGTCACTGAACTTGTCACTGGCATTGACTTAGTCAATTGGCAACTCCTCATCGCCCAAGGTTATCCATTACCCAAGACTCAGGAACAGATCCAACTAAAAGGGCATGCCATCGAGGCACGGTTATATGCAGAAGATCCTAGCCAAGAGTTCCAACCTCAATGTGGAACCGTATTACGGTGGCGCTACCCAACAACGCCTTACTGCCGAGTTGACTCTGGGATAGAAGAAGGTTCACAGATTAGCATTCACTATGATCCTATGTTAGCAAAGCTCATCGCCTATGGAGAAAATCGCCAACAAGCAATACAGAACCTCGACAAACTCATTGTTCAAAGTGAATTATTAGGCATTACTACCAATCGCCACTTTCTCCAAGAATTACTGAATCAGGAAGATTTTATTGCGGGTACTGCTGACACAGACTCTCTTGAATCTCTGTCCCTGCAAAGCATCCAACCTCAATCGCCTACACCAAATCATTTAGCCCTTGCTGCAATCTTATTTATTCGTCAACAACAACAAAAGATGCAAGTACAGAAGGAATTTATCGGGCTTTGCACAGGTTTACCGGTAACCAATGACATTAGACTCGCTACGAATACAGGTTATTACGAACTTAATGTACAAACCCTTGATGCACAAACCTATCGCGTTCGTCAGGATGAGTCTGTTATCACAGTAACTCTTACCTCGGATATTTCTGGCCAGTTAGATTTTCTCATTGATGATCAAAGTCATACGCTATTTTACACATTTAACGAAGAGAACTTATACACTCAATTAACGACAGAGCATGGTTGTTGGCAAAATAAAAGCTTTATGAAGGCAGGTAATACCATCGACGCCGATACTCATGTTGTTTCCCCCATGCCAGGAAATGTTGTTAAAGTGAATGTCAAAGTCGGAGAACATGTTCTCAAAGGCCAAACCCTATTCATCCTCGATGCCATGAAAATGGAACATCCCATTAAAGCTAAACTAGACGGCGCGAGCCGCGGTATAGGTCGAGAAATCGCTCTAAAATGTGCCGCAGACGGCGCAAACATTGTTATTGCCGCTAAAACTGATACTCCACATCCTAAGCTTCCAGGCACCATTCATTCAGTGGCGGAGGAAGTTCGCGCTGCCGGTGGACAGGCTCTGGCCGTTAAAATGGATGTACGATTTGAAGAGGAAGTCGAGGCCATGGTCAGCAAAGCCGTCGATACATTCGGCGGCATTGACGCTGTAATTAATAATGCTGGCGCCATAAAACTCTCCAAGGTAGAAGACCTAACACTCAAGCGTTATGACCTCATGCAAAGTGTCAACGCCAGAGCTAGTCCAGCAACGCCCACATCATCAACCTGTCTCCTCCCCGTTAGCTTAAAACCCGAGTGGCTTGCCAGCTACTCGCCTTATACGATAAGTAAGTACGGCATGTCTCTTTTAGCGATGGGTATGGCAGAAGAATTTCGCGAGTATGGTATTGCTGTGAATGCCCTATGGCCTAAATCTGTCATAGCCACCGCCGCTGTAGAGTTTGAGCTTGCGGAAAAAAGCCTCTTCGAACAATGCCGTCAGCCAACTATTATGGCCGATGCCGCCTACGAAATACTCTGTACCAGAGAGCTAGAACTGACAGGCCAGTGGCTGCTCGATGAGACTTTATTGCGAGATCGCGGTGTCAATGATTTTGAAAAATACCGTTATAACCTAGACACTGACAAACAATTGATGACAGATCTTTTTGTTGACGAGTAG

Transcript

ANN36710-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q54KE6	Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial OS=Dictyostelium discoideum OX=44689 GN=mccA PE=3 SV=1
Q5I0C3	Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial OS=Rattus norvegicus OX=10116 GN=Mccc1 PE=1 SV=1
Q99MR8	Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial OS=Mus musculus OX=10090 GN=Mccc1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002515 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02786 all species →	CPSase_L_D2	Carbamoyl-phosphate synthase L chain, ATP binding domain	Domain	Interproscan
PF02785 all species →	Biotin_carb_C	Biotin carboxylase C-terminal domain	Domain	Interproscan
PF00289 all species →	Biotin_carb_N	Biotin carboxylase, N-terminal domain	Domain	Interproscan
PF00364 all species →	Biotin_lipoyl	Biotin-requiring enzyme	Domain	Interproscan
PF13561 all species →	adh_short_C2	Enoyl-(Acyl carrier protein) reductase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR016185 all species →	Homologous_superfamily	Pre-ATP-grasp domain superfamily	Interproscan
IPR005482 all species →	Domain	Biotin carboxylase, C-terminal	Interproscan
IPR005479 all species →	Domain	Carbamoyl-phosphate synthetase large subunit-like, ATP-binding domain	Interproscan
IPR005481 all species →	Domain	Biotin carboxylase-like, N-terminal domain	Interproscan
IPR011054 all species →	Homologous_superfamily	Rudiment single hybrid motif	Interproscan
IPR020904 all species →	Conserved_site	Short-chain dehydrogenase/reductase, conserved site	Interproscan
IPR050856 all species →	Family	Biotin-dependent Carboxylase Complex	Interproscan
IPR002347 all species →	Family	Short-chain dehydrogenase/reductase SDR	Interproscan
IPR000089 all species →	Domain	Biotin/lipoyl attachment	Interproscan
IPR011053 all species →	Homologous_superfamily	Single hybrid motif	Interproscan
IPR036291 all species →	Homologous_superfamily	NAD(P)-binding domain superfamily	Interproscan
IPR011761 all species →	Domain	ATP-grasp fold	Interproscan
IPR001882 all species →	Binding_site	Biotin-binding site	Interproscan
IPR011764 all species →	Domain	Biotin carboxylation domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR18866 all species →	CARBOXYLASE:PYRUVATE/ACETYL-COA/PROPIONYL-COA CARBOXYLASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0016491 all species →	Molecular Function	oxidoreductase activity	Interproscan
GO:0004658 all species →	Molecular Function	propionyl-CoA carboxylase activity	Interproscan
GO:0005739 all species →	Cellular Component	mitochondrion	Interproscan
GO:0046872 all species →	Molecular Function	metal ion binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for ANN36710-RA.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora grisea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora grisea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →