Gene detail

Detailed information of ANN38862-RA in Montipora grisea

Genomic Location: Scaffold_4892__1_contigs__length_30859:18020...20294
NR annotation: KAF9396987.1, hypothetical protein CPC16_000023 [Podila verticillata]
Species Montipora grisea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN38862-RA

ATGAAGATCGGCGCATTCGAGATCGGCAACGACGAGAAGCTGTTTCTCATCGCCGGGCCGTGCGTCATCGAGTCCGAGGCCCTGGCGCTGGAGACGGCCGGGACGCTCGCACGGATCGCCGAGCGGCACCGTGTCGGCCTCGTCTACAAGTCCTCCTTCGACAAGGCGAACCGGACCTCGCACCAGAGCTTCCGGGGGCTCGGCATGGAGGCCGGGCTGCGGATCCTCGAACGGGTCCGCGCCGAGGTCTCCGTCCCCGTCATCACCGACGTGCACGAGGACACTCCGCTCGACGAGGTGGCCTCGGTGGTGGACGTGCTCCAGACCCCGGCGTTCCTGTGCCGCCAGACCAACTTCATTCAGGCGGTGGCGCGCTGCGGCAAGCCGGTGAACGTCAAGAAGGGTCAATTCCTCGCGCCGTGGGACATGACGCACGTGGTGCACAAGGCGAGGGCCGCCGGCAACCCCGACATCATGCTCTGCGAGCGGGGAGCCTCGTTCGGATACAACTACCTGGTCTCGGACATGCGCTCGCTCATGGTGATGCGGCAGACCGGCTGCCCGGTGGTGTTCGACGCCACCCACTCGGTGCAGATGCCCGGCGGCCAGGGTCCGCGCTCCGGGGGGCAGCGCGAGTTCGTGCCGGTGCTCGCGCGCGCCGCGGTGGCGGCGGGGGTCGCGGGCCTGTTCATGGAGACCCATCCGGATCCGGACGAGGCGTTGAGCGATGGGCCCAACGCCTGGCCTCTCGGCCGGATGGAGGCGCTGCTCGAATGCCTGCTCGCGATCGACGATGTCGTGAAGTCTCGTCCGCGGGCGGAGGACGGCTTGGAGATGATCCGGAGGTGGGGTGTGTTCCGGAGCCGATACGCCGGTGGAGCGCCTGAATTGCGGCCCGTCCGGGACATCGTCGCCCGCGAGATCCTCGACTCGCGAGGCAATCCGACCGTGGAGGCCGACGTCGTTCTCGACGGCGGCGAGATTGGCCGGGCCGCGGTGCCTTCCGGCGCATCGACGGGAAGGCGCGAGGCGCTGGAGCTGCGCGACGCGGATCCGAAGCGGTTTTGCGGGCGCGGGGTCCGGCGGGCCGTCGCGAATGTCGAGGAGAAGATCCGGCCCGCGCTCGTCGGCATGGATGCGACCGATCAGGACTCGATCGACGCCACCATGCTGGATCTCGATGGCACGGAGAACAAGGCGAACCTCGGCGCGAACGCGATCCTGGCGGTTTCGCTCGCATGCGCGAAGGCCGCGGCCCGCGCCGGCGGGCTGCCGCTCTACCGGTATCTCGGCGGGGCCGGGCCGTTCCGCATGCCGGTCCCGATGATGAACATCGTGAACGGGGGCGCACACGCCGACAACAACGTCGACATGCAGGAGTTCATGATCGTTCCGACCGGTGCGCCGGATCTGCGCGAGTCGGTGCGCTGCGGCGCCGAGGTGTTTCATTCGCTGAAAGCGGTGCTGAGCGGGCGCGGGCTCGCCACCGCGGTCGGCGACGAAGGCGGCTTCGCGCCCGATCTCGCCTCCAACGAGGAGGCGATCGAGGTGATTCTCGAAGCGATCGGGAACGCCGGCTACTCGGCCGGCGGGGACGTGCACCTGGCCCTCGACGTGGCAAGCTCCGAGCTCTACCGCGACGGGAAGTATCACCTCGGCTCGGAGGGAGTGTCGCTCGACTCCGAGGCGTTCGCGGATGTGCTGGCCGGCTGGGCCGAGCAGTATCCGATCGTGTCGATCGAAGACGGCATGGCCGAAGATGACTGGGAGGGCTGGAGGCTGCTGACCGAGCGACTCGGTGGTACGGTGCAGTTGGTCGGCGACGATCTCTTCGTGACGAATCCAGGGATTATTTCCAGGGGGATCGCCGAGGGCGTCGCGAACTCGGTGCTCGTCAAGGTCAATCAGATCGGTACGCTCACCGAGACCATCGAGGCGATCGAGACCGCGCGTTCGGCCGGCTACACCGTGGTGATCTCGCACCGCTCGGGAGAGACGGAGGACACCGCCATCGCAGATCTCGCGGTCGCGACCGGCGCCGGACAGATCAAGACCGGCTCGCTGTCGCGATCGGATCGGGTCGCGAAGTACAACCGCCTCATCCGCATCGAAGAGAGCCTCGCGCCGGAGGGTCGGTCGAGCTATCCGGGGCTGCGGGCGCTGCACGGCATGGCGGGAGAGGCTGGCGGTGCAACCCGAACCGGCCGGGACTGA

Transcript

ANN38862-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q2Y9P0	Enolase OS=Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71) OX=323848 GN=eno PE=3 SV=1
Q1H011	Enolase OS=Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT) OX=265072 GN=eno PE=3 SV=1
Q3JCT1	Enolase OS=Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107) OX=323261 GN=eno PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002890 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03952 all species →	Enolase_N	Enolase, N-terminal domain	Domain	Interproscan
PF00113 all species →	Enolase_C	Enolase, C-terminal TIM barrel domain	Domain	Interproscan
PF00793 all species →	DAHP_synth_1	DAHP synthetase I family	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR020811 all species →	Domain	Enolase, N-terminal	Interproscan
IPR006269 all species →	Family	3-deoxy-8-phosphooctulonate synthase	Interproscan
IPR020809 all species →	Conserved_site	Enolase, conserved site	Interproscan
IPR029017 all species →	Homologous_superfamily	Enolase-like, N-terminal	Interproscan
IPR036849 all species →	Homologous_superfamily	Enolase-like, C-terminal domain superfamily	Interproscan
IPR000941 all species →	Family	Enolase	Interproscan
IPR013785 all species →	Homologous_superfamily	Aldolase-type TIM barrel	Interproscan
IPR020810 all species →	Domain	Enolase, C-terminal TIM barrel domain	Interproscan
IPR006218 all species →	Domain	DAHP synthetase I/KDSA	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11902 all species →	ENOLASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0008676 all species →	Molecular Function	3-deoxy-8-phosphooctulonate synthase activity	Interproscan
GO:0000015 all species →	Cellular Component	phosphopyruvate hydratase complex	Interproscan
GO:0000287 all species →	Molecular Function	magnesium ion binding	Interproscan
GO:0004634 all species →	Molecular Function	phosphopyruvate hydratase activity	Interproscan
GO:0006096 all species →	Biological Process	glycolytic process	Interproscan
GO:0009058 all species →	Biological Process	biosynthetic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01649	leuA, IMS; 2-isopropylmalate synthase	EC:2.3.3.13	Valine, leucine and isoleucine biosynthesis	ko00290	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora grisea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora grisea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →