Gene detail

Detailed information of ANN39735-RA in Montipora grisea

Genomic Location: Scaffold_4024__1_contigs__length_33638:6810...9488
NR annotation: WP_142896829.1, aconitate hydratase AcnA [Denitrobaculum tricleocarpae]
Species Montipora grisea · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ANN39735-RA

ATGCCTGTTGGACAGGACACCCTGAAGACCCGCAAAAGCCTGACGGCGGCGGGCGAAAGCTACGACTATTTCTCTCTTGAAAGCGCCGCCGAGACCATCGGCGACATCTCGCGCATGCCCTTCTCCTTGAAGGTGCTGCTGGAGAACCTGCTGCGCTATGAAGACGGCGTCACGGTCACGACCGAGGACATCCAGGCCCTGGCCGACTGGCAGAAGGAGCGCAAGAGCCCGCGCGAGATCGCCTATCGTCCGGCCCGCGTGCTGATGCAGGACTTCACCGGCGTACCCGCCGTGGTCGATCTGGCCGCCATGCGCCAGGCCATGGCCAAGGCCGGCGGCGATCCCAACCGCATCAATCCGCTCTCTCCGGTCGATCTGGTGATCGACCACTCGGTCATGGTCGACGCCTTCGGCGGCCCGGACTCCTTCGAAAAGAACGTGGAGCTGGAGTTCGAGCGCAACGGCGAGCGCTATTCCTTCCTGCGCTGGGGCCAGAGCGCCTTCGATAACTTCCGCGTCGTGCCGCCGGGCACCGGCATCTGTCACCAGGTCAACCTAGAATACCTGGCCCAGACCGTCTGGACCGCCGAGGAAGAGGGTGCGACCATCGCCTATCCCGACACGCTGGTCGGCACCGACAGCCACACCACCATGGTCAACGGCCTAGCGGTGCTGGGCTGGGGCGTGGGCGGCATCGAGGCCGAGGCGGCCATGCTGGGCCAGCCGGTCTCCATGCTGATCCCCGAGGTCATCGGTTTCAAGCTGACCGGTTCTCTATCCGAGGGCACCACGGCCACCGACCTGGTGCTGACCGTGACCCAGATGCTGCGCGCCAAGGGCGTGGTCGGCAAGTTCGTGGAGTTCTACGGCCCCGGTCTGGAGTCCATGACCCTGGCCGACCGGGCGACCATCGCCAACATGGCCCCCGAGTACGGCGCGACCTGCGGCTTCTTCCCGATCGATGAAGAGACCTTGCGCTATCTGGCCTTCACCGGCCGCGATGAAAAGCGCGTGGCGCTGGTCGAGGCCTACGCCAAAGCCCAGGGCATGTGGCGTGACGCCAGCTCTCCCGACCCCGTCTTCACCGATAGCCTGGAGCTGGACATCTCGTCGGTCGAGCCGAGCCTCGCCGGCCCCAAGCGCCCGCAGGACCGGGTGCCGCTCTCCAGCGCCGCCAGCTCGATCAAGGAGCTGCTCGCGGGCGAGCCCGAGCCGGCCAAGAGTATGCCGGTCGCGGGCCAGAACTACGAGCTCGACAACGGCGACATCGTGATCGCCGCCATCACCTCCTGCACCAACACCTCCAACCCCTCGGTCATGGTCGCCGCGGGTCTGGTCGCCAAAAAAGCGCTGGAAAAGGGCCTGACCGTCAAACCCTGGGTCAAGACCTCCCTGGCGCCGGGCTCCCAGGTCGTGACCGAATATCTGGAGGCCGCGGGTCTGCAGGACGATCTCGACGCGCTGGGCTTCGATCTGGTGGGCTATGGCTGCACGACCTGCATCGGCAACTCAGGCCCCTTGCCTGACCCAATCGCCGAGGCCGTGAGCGAGGGCAACCTCCTGGTCACCTCGGTGCTGTCGGGCAACCGCAACTTCGAGGGCCGCGTCTCCCCGCAGGTGCGCGCCAACTACCTCGCCTCCCCGCCGCTGGTGGTGGCCTACGCCATCGCCGGCTCCATGACGGTCGACCTGCTGAACGACCCGCTGGGCGAGGATGCTGACGGGAACCCGGTCTACCTTAAGGACATCTGGCCGACCAATCAGGAAGTCGTGGAGACGGTTCAGAAGGCCCTCAGCCGCGATATGTTCGTTGAGCGCTACGGCAACGTCTTCGAGGGCCCAAAGCAGTGGCAGGCCATCGAGGTCGGCGCGGGCAAGACCTTCGAGTGGGACCCCACCTCCACCTACGTCGCCTATCCACCCTTCTTCGAGGATGTGGCCGGCGACCCTCAGCCTGTGACCGACATCAGCGGGGCCAAGATTTTGGCCAAGCTGGGTGATTCCATTACCACGGACCACATCTCCCCGGCCGGGGCCATCAAGCAGGAGAGCCCGGCGGGCGAGTATCTCAATGGCCATCAGGTCCGGGCCAGGGACTTCAACTCCTACGGCTCGCGGCGCGGCAACCACGAGGTCATGATGCGCGGCACCTTCGCCAACATCCGCATCAAGAACGAGATCGCGCCTGGCACCGAAGGCGGCTTCACCAAGTACCAGGGCGAGGTCATGCCGATCTATGACGCCGCCATGAAGTACGCCGAGGAGGGCATCCCGCTGGTTGTGGTGGCCGGCAAGGAGTACGGCACCGGCTCTTCGCGCGACTGGGCGGCCAAGGGCACCAACTTGCTGGGCATCAAGGCCGTGATCGCTGAAAGCTTCGAGCGTATCCACCGCTCCAACCTGGTTGGCATGGGCGTACTGCCCCTGCAGTTCAAGGAGGGTGACAGCCGCGAATCCCTGGGCCTGACCGGCGACGAGACGGTGGACATCACCGGCATCGAGGCCGGCATCACGCCGCGCATGGACATTCCCTGCAGCTTCACGGCGCCCGAAGGCGCCAAGACCGAGGTGACGCTGCTCTGCCGCATCGATACCGCCAATGAGGTCGAGTACTACAAGAACGGCGGCATCCTGCAGTACGTCCTGCGCAACATGATGGCGGATGACAAAGCCGCCTAA

Transcript

ANN39735-RA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9I3F5	Aconitate hydratase A OS=Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1) OX=208964 GN=acnA PE=3 SV=1
P37032	Aconitate hydratase A OS=Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513) OX=272624 GN=acn PE=1 SV=1
Q8ZP52	Aconitate hydratase A OS=Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720) OX=99287 GN=acnA PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002370 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00330 all species →	Aconitase	Aconitase family (aconitate hydratase)	Family	Interproscan
PF00694 all species →	Aconitase_C	Aconitase C-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR006249 all species →	Family	Aconitase/Iron-responsive element-binding protein 2	Interproscan
IPR044137 all species →	Domain	Aconitase A, swivel domain	Interproscan
IPR015931 all species →	Homologous_superfamily	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomain 1/3	Interproscan
IPR001030 all species →	Domain	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha domain	Interproscan
IPR000573 all species →	Domain	Aconitase A/isopropylmalate dehydratase small subunit, swivel domain	Interproscan
IPR036008 all species →	Homologous_superfamily	Aconitase, iron-sulfur domain	Interproscan
IPR018136 all species →	Binding_site	Aconitase family, 4Fe-4S cluster binding site	Interproscan
IPR015928 all species →	Homologous_superfamily	Aconitase/3-isopropylmalate dehydratase, swivel	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11670 all species →	ACONITASE/IRON-RESPONSIVE ELEMENT FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003994 all species →	Molecular Function	aconitate hydratase activity	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0006099 all species →	Biological Process	tricarboxylic acid cycle	Interproscan
GO:0006101 all species →	Biological Process	citrate metabolic process	Interproscan
GO:0030350 all species →	Molecular Function	iron-responsive element binding	Interproscan
GO:0051539 all species →	Molecular Function	4 iron, 4 sulfur cluster binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for ANN39735-RA.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora grisea tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora grisea, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →