Gene detail

Detailed information of Actinostola_13984 in Actinostola sp. cb2023

Genomic Location: scaffold31_size1034888:447219...463544
NR annotation: no NCBI-NR hit recorded
Species Actinostola sp. cb2023 · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Actinostola_13984

TTGTTAACTGCCCATTTTCACCAGGTTGGTAAGGAACTCTCTCTGCCAAGAAAAGGATGGACATTGTACAAAAACAGAAATAAAACAGAGAAGATTGAAAACTCATCTAGAAAAACCCTTGATCATATATCTATCAAGTGTCACCATGGCGACCATAGCAAATGCATACATTGTGTTCCTTTAGAGCCATATAATGAGACGTACCTAAAGGAGCATGATCCACCAATTAAACACATGTCATTTCATGCATATCTGAAGAAGATCTCCCATGGGACTAACAAATGTCGGTTAAAGGAGCTCCAATCTACCCAACAACCCTTTAAAAAACAAGCAGATGCGATTTCTGCAAAGGATGAAGAAGAGATGTGGAGCCAAGGGATACTGGGGACACATTGTCCAGATGCCGTTCTCAACGCACTTATGTTTCTTAGCGGAAAGTTATTCGTGTTGAGAGGTGGAAAGGAGCAACGGGAATTGTCACACGACCAGTTCGTGCTGGAAAAACAGAAGGAGAATGGCTTGATGCTTGTGATATTCAAAGAAAAGGTTTCCAAGACCAATCAAGGTGGGCTGAAGAGGAGGAAAGTAGACCGAAAGGAAGTTCGCCATGTAGAAGACCCTACGAGTGAGAAATCCTTTACCTTCATTTATAACTTCTACATCAGTAAATGCCCAGAAACTGTTCCAGTGCCAGCCTTTTACTTGAGACCGAAAGCAATGTGGAAATATTCTGATCAAGTTTGGTTCGAAAAGAGTCCCATGGGCCATAACACCATTGATAAAAGATTCAAAAAAATGTGCAATGATGCTGGCTTGGAGGGTAATTTTTCAAACCACTCGGGTCGTGTAACAGGTATTACCAGAATGTACCAAGCAGGATTACCAGAGAAATTGATAATGAACAGAAGTGGCCACCGATCCATTGAAGGTGTAAGAGCATATCAGAGAGAAAATCCTAATGATGTTAGTCGGGTCTCCCATGCACTGAGCAGTCCAGCTACAGTAGAATTCCAGAAGAATGCAGTAACAACTCCAAAGAAAACTAAAAGTAACGATGTGGCTACAGATCAGCATGACGATGATGTGATGCTAGAATATAGACATGTGGACAACATATTGTTTGAAAATCCCTCAATTGTAGAACCTTTTTTAGATTACTGGAGAAAAACAGGAAACCAGCGTATTGGTTTTCTCGTTGGTCGATATGAGCACCATAAAGAAGTACCCCTGGGCATTAGAGCTGTTGTCGTTGCTATATATGAACCCCCTCAGGAATGTACTCCAGACAGTGTTGAACTTGTAGAAGACACTAATATAGGAGCCGTGCAGCAGTTAGCAGCTGAACTTGGCCTTCAAGTTGTTGGCTGGATATTCACAGACTTGGTACCAGAAGACGTCAAGAAAGGAACAGTTAAACAGTTACGAGGGATTGATACACACTTCTTGACTGCAGAAGAGTGTGTCATGGCAGGAGACTTTCAGAATCAGTTTGCGTCGACTTGTCGGTTTGCAGCTACTGGAAAGTTTGGGTCAAAGTTTGTCACGGTTGTTGTATCAGGTCACGAGGGAAATCAAATTGGTTTTGATGGTTATCAGGTATCAAATCAGTGCATGGCTCTTGTTAGAGATGAGTGTCTTGTTCCTACTATAGATGAACCTGGTCTTGGATACATCAGGGAGTCTACTAGTCATCAATATGTTCCTGATGTATTTTATAAAGACAAAGATTCCTACAATAATGAAGTCACAATGTTGGCCAGACCTATGCCGATAGAGTATGTCTTAGTGCAGGTTGCAGCTGCCTTTCCTGTTGATTCTTTGTACACTTTTCCACGCACAAAAAACGGTGCTGTGTTCCCTATAGAACACAGAGAGAACATTGGAGAATGTCAGAATATTGATGCTGTCATGAAGCACCTCAACCAGCATCCCACAAGTGAATTCCTACTCGCAATGAGCAACTTTCATTTGCTTATTTTCCTTGCAACAAGTGACATGCTACCAACTAAGAACCGTTTAGCGCCATTATGTGAAGCCATCAAGAATCAAGATATAGAAGCGTTAGACAGATGGAGAAAAGGCGAACACTGGCGAACAGTTGAAGAGATCATTGCCGCACACGACTATGACGGCTTCAAAACATCACCTTATCTCAATGATATTCATCCTGATATTGTACTAATTACTTACCCAGGACCTACGCCTGGTCAACACTCACATCCAGCTGGTGATGTTGATATGGAGGATGTTAGCCAGCAGACAGGATCATCATGGACATGCAAGCATTGTACTTTTATCAATCAGTATAGAGAATCATGTGAGATGTGTGGGTTGCCCAGGAATTGA

Transcript

Actinostola_13984

Protein

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004918 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF05021 all species →	NPL4	NPL4 family	Family	Interproscan
PF11543 all species →	UN_NPL4	Nuclear pore localisation protein NPL4	Family	Interproscan
PF05020 all species →	zf-NPL4	NPL4 family, putative zinc binding region	Family	Interproscan
PF12012 all species →	DUF3504	Domain of unknown function (DUF3504)	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR007717 all species →	Domain	Nuclear pore localisation protein NPL4, C-terminal	Interproscan
IPR024682 all species →	Domain	Nuclear pore localisation protein Npl4, ubiquitin-like domain	Interproscan
IPR036443 all species →	Homologous_superfamily	Zinc finger, RanBP2-type superfamily	Interproscan
IPR016563 all species →	Family	Nuclear protein localization protein 4	Interproscan
IPR007716 all species →	Domain	NPL4, zinc-binding putative	Interproscan
IPR037518 all species →	Domain	MPN domain	Interproscan
IPR021893 all species →	Domain	Domain of unknown function DUF3504	Interproscan
IPR011010 all species →	Homologous_superfamily	DNA breaking-rejoining enzyme, catalytic core	Interproscan
IPR013762 all species →	Homologous_superfamily	Integrase-like, catalytic domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12710 all species →	NUCLEAR PROTEIN LOCALIZATION 4	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006511 all species →	Biological Process	ubiquitin-dependent protein catabolic process	Interproscan
GO:0031625 all species →	Molecular Function	ubiquitin protein ligase binding	Interproscan
GO:0043130 all species →	Molecular Function	ubiquitin binding	Interproscan
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0006310 all species →	Biological Process	DNA recombination	Interproscan
GO:0015074 all species →	Biological Process	DNA integration	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K14015	NPLOC4, NPL4; nuclear protein localization protein 4	-	Ribosome biogenesis	ko03009	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Actinostola sp. cb2023 tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Actinostola sp. cb2023, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →