Gene detail

Detailed information of Ahemp_002368-T1 in Acropora hemprichii

Genomic Location: scaffold_4:5394447...5402143
NR annotation: XP_015776448.1, PREDICTED: mitochondrial inner membrane protein OXA1L-like isoform X2 [Acropora digitifera]
Species Acropora hemprichii · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

Ahemp_002368-T1

AGCAAGATGGCGGCGTTCTTTTCACGTGTGGGCCAGAATGGCCGACAGTTCTACAGAATGTCAGCCTGCCTAAGAGCTTGGAGAGTTTCAAGGATTGCTACTCTTAAGACATTTGCAGATCCCTTTTCTCGGAGCCTCGTCACAGATACTATGGCGAGACAATCCAGCCATGCATCTTCGAGATTTTATGGAGGTCTCAAGTGTAAAGGTGTTGTATATGGAAATATTCCTGTTTCTGTGCAAGGAGCAAGATTTTTATCTCTGTGGCCTTGGAGCTCGAGCACATCTAATTCAGATATAGCCCAAGAAAAGTTTCCTGTGCCAGAACTTATCAAAAATGAGCCACAGACTCCAGAAGTAACAAACGATTCTGTAGCAAATCCATTTCTTCACGAGAATCCATCTAACTCTCTACTAGATGGTGAGCTACTAAATGACATGGCAGATACAGTGTCCTCTCTAGGTGAACCCAGTTTGGCTAGTTTAGGCCTGGGTGGATACTCACCAACTGGTCTTATTCAGCAAGCTCTAGAACTAATCCATGTGCAGGGAAATTTGTCATGGTGCCTCTCCATAGCCCTTTTTACTGTTATTGTACGTGTGGTCTGTCTACCGCTAATCATCAAAGCACAAGCCAACACTGCAAAAATGAACAACATCAGACCACAGTTAGAAGAAGCTCAGGCAAAGTTAAGGGAGCTGGCCAATTCCCATGATTCAGTAGCCAAGGCAACAGCCAGTATGAAATTATCCCAGCTGTACAAGGATAACGACTGTCATCCATTAAAGAGTATTCTTGCACCTATTGTACAGATACCACTTTTTGTATCCTTCTTTTTTGCCTTGAAAACGATGGCAAACTTACCCGTGGAGTCTTTAAAGACAGGAGGATACTTATGGTTTCAAGACCTGACTGTGTTTGACCCATATTTCATTTTGCCTGTGATATGTAGCTTTTCAATGCTGGCTTCAGTTGAGCTTGGTTCTGAGATGGGAGTGAACAATCCTACAATGAAAACAATGAAGACCGTGATGCGCATCGTAGCCGTGGCAACAATTCCGATCACTGCACAGTTTCCAGCTGCAATTTTTGCATACTGGGTAACATCTAACCTGTTTACAGTAGGACAAGTTGCAATACTGTCGCATCCTGCTGCAAGAAAGGCAATGGGAATACCGGAAATGGTGCCTTACGAAAGTGCCAATAGTGGTAGCTTTTGGGAAAACTTGAAAGCAGGCTACACAAATTCACAGGAGGCTGCCTATATCAGACATGCTGAGAAAATGAAGCAACAGCGTCAGAAAGCGTTAGGTGAGGCCCCTTTGGAACCCACCTACGAGTTGAACCCAAGGATCAAGGAAAACATGGAAATGTTCGAAAGTTTGCAAGATAAGTCAGCACAGACTGCCCAATCGTATTCCGACCCTGGTGCCTCTGGGCGGCAAGTAGGAAATGGCGCGGACTTTAAATCCAGAAGAGTGAGGTTCAACCAAGAAATTTTTAGTGGAACAATGAGCAGACAAGCTAAGAAGGAGAAACAGAAAGAAAGGGATCGACTGAGGAACAGACCAGGAGCAACAATGTGAGACGGTCCTCCTGAATGTTCTCCAAGCAAGATGATGTGGCTGTGTAAACAGAGCTGAACATAAAACCATGCGAATAATTCATCGAGTTTGAAAACGAGTTAGGAATTTTCTTTGCTATCAAGCAATTTGTACTGGAACATCCGTAATTAAATGCTGTTGTTTCCCGTGCAAAATCAACACCACAGGACACTTTTGAAAATATGTAATGGGGATGGATTAATTGCTTGGAAGCAGGCAGTTTCCCTTGAAAACAATGCTTATTTCTTTCATTTGATAGATTTCCAAAACCCATAATCAGCGACATATACATTGTACTTGTTGAATGTTGCAATGGAAACCAACGGTCGCTTCTGCATTCTTTTCTACAGCCAGCCCATTGCTCTTCTGAACAGCTAGATTTTTAGGCAAGCACTTTTAACTAAGTGGGGAATACCAGGCCTTTGGTGCTGTGGATAAGCTCTTGTACAGTTACTGTAAAGGGATAGACGCTGATCGGAGTGGAGTATAAATAAATGCGTTTTTTCTTGTAAGGCTTGCGTTAATTAGATTGTCGCAGTATCGATCTGTGGAAATGGAGTCTCACAATTGTATGGTCTTCAATGCCCC

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8BGA9	Mitochondrial inner membrane protein OXA1L OS=Mus musculus OX=10090 GN=Oxa1l PE=1 SV=1
Q3SYV3	Mitochondrial inner membrane protein OXA1L OS=Bos taurus OX=9913 GN=OXA1L PE=2 SV=1
Q15070	Mitochondrial inner membrane protein OXA1L OS=Homo sapiens OX=9606 GN=OXA1L PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006256 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02096 all species →	60KD_IMP	60Kd inner membrane protein	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR028055 all species →	Domain	Membrane insertase YidC/Oxa/ALB, C-terminal	Interproscan
IPR001708 all species →	Family	Membrane insertase YidC/ALB3/OXA1/COX18	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12428 all species →	OXA1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0031305 all species →	Cellular Component	obsolete integral component of mitochondrial inner membrane	Interproscan
GO:0032977 all species →	Molecular Function	membrane insertase activity	Interproscan
GO:0032979 all species →	Biological Process	protein insertion into mitochondrial inner membrane from matrix	Interproscan
GO:0051205 all species →	Biological Process	protein insertion into membrane	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K03217	yidC, spoIIIJ, OXA1, ccfA; YidC/Oxa1 family membrane protein insertase	-	Secretion system	ko02044	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora hemprichii tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora hemprichii, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →