Gene detail

Detailed information of Ahemp_011850-T1 in Acropora hemprichii

Genomic Location: scaffold_43:1132800...1135635
NR annotation: XP_015780003.1, PREDICTED: volume-regulated anion channel subunit LRRC8A-like [Acropora digitifera]
Species Acropora hemprichii · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Ahemp_011850-T1

ATGTTTCCAGTGGAAAAACTGTCCCAGTTTGAGTCAACGAACGCTTCGTACAGAATCCTGAAGCCATGGTGGGATGTATGCACTGACTATCTGGCACAAGCCATACTGCTGATTGCTTTGTCTGCAGCGGCAATGCAAGCACTACAAGGTGATGTCATCTGTCTTCCAACAGCTGAATGCAACTTCAACCTAAACAAGGCAGCCAACTATTCAAGGAATGGTAGCATTCCAGTTTCCACAAGCTTCCTGAGGGCAAACCGTAGCTTTTGTCAAAAATATTACGCTTCGGCCACAAGGGACTCAAGAATGACGGTAATCGCATTTACCAAACTAGAAGATAGACGGCAGTACGACTTTGTGGATGCCCAGTGCGGTCAGGAAGCTTTACACTGGTTTGCATCATACTTGCCGTTAATCCTTTTTTTTCAAGCAGCGATACTTGTGATTGTTGATAACTTTTGGTTGAAGTTTCCTAAGACGTCTTCGACCATTGATCATTTTGTAAAGCTGGTTTTGGAGTGTTTTAATTCTTCAGGGACATGCTTGGATGTGTCTAATGTCTTGTGGGGAACAAATATTTCCGATAAAGCCGAAAGCAAAGTGTCAGAAGACATAGAAAAAGGTACTAGGGAAAGATACAAGCTCCTCCCGGAAGAACCTCTTGCAGTGCGAAATCCACCAACTGAGACAGATAGAGATCCAACCTCGGCCTTTGAGCTTTCTGAAGCCATCAAAGCCAAGACGTTGTGCGAGAAAATACGACACTTTCGAAAAGATGTCGAATCATATCAAAACCATCGATTTTTGGTGGGGATATATCTAACTCAAGCCTTCATTCAATGTGTGTTTTCACTGGTGTCTTTCATCTTTAATATCTGCCATCACAACAAAGTAAGAAGCACATTGAAATGCGATATCGATGGCACAATTGATGGACATTACGATTTCTTTAAGTGCTCATATGGTATTGCTGCGTACTTTCGCTTTTCACTATATATATTTTATGTGCTTATAACTGTGTATTGTCTGGTATGTGTTTTCATCTGCCTTTGGACAGCGTACGTGTGGAAGTTCAAAACACCGTTTTCCTTCAAAGAGGTGCGAAGGTTTGATACGGAGGCATTAAAGCTAGGTGACATAAATGACGCCCATGGAGACCTCGCCTTGATGCTTCATCTTTTGAATGAGTATAATAAACTATACGTGTATAGGTTTGCTGTGTTCTTGTCACAAAAGAACGAAAAGAGTCTTAAAAACTTCATACTCTGGAAGGAATGGCCACTTGATAAATTGCAAAGGATGAGTACCGAAAATGGAACTAAATTAAGCTTAAACAGCTTGTCTGGAATCCCTAAGACTATTTTCCAGTTGTCGGAGCTAGAGTCGTTAACACTGGAAGACTGCACTTTGACAGAAGAGGATTTCGACCCCGAGGATTGGCGAAAACTTGAGCTACGATCACTTTCATTGGTGAGATGTCGCTTGGAGTCTATCCCTGAAGCAATCTTTCAAAACTGTGAATTCCTTGAAACATTAGACTTGTCCTACAACAGGATCAAAAGTGTCCCTGAGAATATAGCAGCCCTTCATTACTTACACACGTTGAATATTGCTGGCAACCAGGTGACTGAAGGTGTGGAGCATATCATGAAGATTGACAGTCTCACAGTTTTAAATTTAAGGGAAAACGATTCCCTCCAGAATGTTCCAAATGGAATTGTTGGTCACCGGGGGATAAGGAAACTGTACGTTAACGAAAATGTTGTTTCAAAAATGTCGGAGGAAATGAAAGAAAACCTCAAAGGTATAATTGTTACAGGAAGCAGATCTCCTGGTGACATCACAGTGATAGAGTACTCACCCTTGAAGGCCCCACACATTGAAAAAGCAAGGAATGACAGAGAAAAAGTGTACAAAATGACTTCAAAACCGAAAGGCCTAGCTTTGATTTTCAACTTTTTTTCCTATGAGCCTCATGCGGAAAATCGTCTTGGGTCAAACGTTGATGTTGAAAGTCTGGAAAAGCTGTTTAAGGGTATCGGTTACAACGTACAAGTTCAACTAGACCCTTCCTCGGCCAGGGATTTCGAAACTCAGTTGAAGGACCTTCCTGTAAATCATGCGATTGGCGACTCGGTTATTGTGGCTGTGATGGCACATGGCTCAAATGAAGGTGTGATTTGCTGTAACGGAGATATTTTTTCAGTCAATAAGATAGTTTCTATTCTTGGCAACGCTGATGCCTACCTTGGCAAGCCCAAGTTAATTTTTATTCAAGCGTGTCGTGGCTCTCGTTGGTCCCACGTTCGTACAGAGCCCTCCAGTCCTGTTGAGTTTTCATCGCACAATGTCAGAGTAGGAATACCAACGATGCATCTTCCAACTATATCACGGAAACCAGTCGAGAGTGATGCAGTGCTCCCTGATGCTGAAGAAAGAGAAGACTCCGATTCTTTACCACTCGACATACCGGTTTATTCTGATGTGCTTATTGGCTATTCCACTCTTCCTGGTGTTGTCTCGATACGGAGCAAAAAGGATGGTTCATGGTACATCCAGAGTCTCGTCGAGGTCTTTTCCCAGTATGCATATGAAGAAGATGTGTTAAGCCTCTTGACGTTTGTCAACTACTACGTATCTCGCAATTTTAAAACCATGAGTGGTTTTAGGCAAATTCCAGCCCCTCAAAGCACACTCACTAAAAAGCTGTTTTTCCTCCCTGGATACTTCGAGGATGACGATCATTCTTCTGCAGCATCCACTTCGACTTAA

Transcript

Ahemp_011850-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8IWT6	Volume-regulated anion channel subunit LRRC8A OS=Homo sapiens OX=9606 GN=LRRC8A PE=1 SV=1
Q80WG5	Volume-regulated anion channel subunit LRRC8A OS=Mus musculus OX=10090 GN=Lrrc8a PE=1 SV=1
Q4V8I7	Volume-regulated anion channel subunit LRRC8A OS=Rattus norvegicus OX=10116 GN=Lrrc8a PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001383 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF12534 all species →	Pannexin_like	Pannexin-like TM region of LRRC8	Family	Interproscan
PF13855 all species →	LRR_8	Leucine rich repeat	Repeat	Interproscan
PF00656 all species →	Peptidase_C14	Caspase domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR021040 all species →	Domain	LRRC8, pannexin-like TM region	Interproscan
IPR001309 all species →	Domain	Peptidase C14, p20 domain	Interproscan
IPR002138 all species →	Domain	Peptidase C14, caspase non-catalytic subunit p10	Interproscan
IPR015917 all species →	Domain	Peptidase C14A, caspase catalytic domain	Interproscan
IPR001611 all species →	Repeat	Leucine-rich repeat	Interproscan
IPR029030 all species →	Homologous_superfamily	Caspase-like domain superfamily	Interproscan
IPR032675 all species →	Homologous_superfamily	Leucine-rich repeat domain superfamily	Interproscan
IPR011600 all species →	Domain	Peptidase C14, caspase domain	Interproscan
IPR033139 all species →	Active_site	Peptidase family C14A, cysteine active site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR47901 all species →	CASPASE RECRUITMENT DOMAIN-CONTAINING PROTEIN 18	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004197 all species →	Molecular Function	cysteine-type endopeptidase activity	Interproscan
GO:0006508 all species →	Biological Process	proteolysis	Interproscan
GO:0008234 all species →	Molecular Function	cysteine-type peptidase activity	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for Ahemp_011850-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora hemprichii tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora hemprichii, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →