Gene detail

Detailed information of BRAKERLUSP00000031649.1 in Blastomussa wellsi

Genomic Location: chr9:15007113...15023646
NR annotation: CAH3028713.1, unnamed protein product, partial [Porites evermanni]
Species Blastomussa wellsi · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

BRAKERLUST00000031649

ATGGTTACTAAGAATTTACAGCAGTTTAACCAGCAGCTTCATGCACGCCAGCCATTGTTCCAGATAGAAACAGTGCTGTCTGCTCCAGAGATCGTCTTGTCTCCTCCTGCAAATGAGATCTACAAGTTAATCATGCAGTCTGTCCGAGACATGGTGGAGGGAACAAGAATGTTTGTCCGCTGGATGAATGGCACGTGTATCGAGACTCCACCCCAGCATGCTGAAGGTGAAGATGAACCAGTGGTGTTCAGTTTCTTCACGGACATCTCTTCCAATCCTGCCATCATAGATACAGTGACAACTTTGTCCAAGAGTGTGCAGAACACTCTGGGAATGCTGAATAAATACTTGACGCGTTGGAGGAGGTACAGACTGCTATGGAAACTTGACAAGAGTAACATGGTGGATAAGTTTGCTCAGAAGAAGCCGACGTGTATTGCATATGATGAAAAACTTCAGTTCTACTCAAATCTAGTCATTGAGGTTGGTAGCCAGGTGATGACAAAAGACGTGGATTTTGTTCGTCTGAACCTCGATCCACTGGCTACAACCATTCAAGCAAATGCAAGAGCCTGGGTCAAGGAGCTTGGCAAGTTCTTGAATGAATCAGCAAGGGAAGATCTGAATGCACTTAAAGGAGAAATTGAGGGTTTAACAGAGGATCTCAAGCGGCCACCTGACACGTTAGAAGACTTGAAATTTGTCCTGCGTGTGATCGCAGACATCAGAGACAAATCTCTGGATGTGGAGCTTCGCTATGTTGACATACAGGAGAGATATCGGACACTTCTCATGTATGATATTGAGGTTCCTGAGGGCGAGTTGGAGTTATCGACCAATATCACTCAAGCCTGGGATGATCTTTTCTTGGAATCTCGCAGGGTGGATGCAAGTTTGGTTTCTGTAAAGAAGAAATTCACTGAAATAACTCAAGATCAAGTGTCCGACTTCTCCAATGACATCTCCAAGTTCAAAGAAAGCTTTATTAATGAAGGGCCAAGTTCCATTGGCATTGATCTGGATGCAGGTGTGGAACTCCTAAAGAGATTCAAAGAGGAGTTTGCTAATTTTGAAAAGGAACGACAAGAGTTGGCGAATGCTGAGAAGTTGTTTGGTCTTTCCATCACTTTGTACCCTGAATTGCTTGACATGGAGAAAGAATTGAAAGGATTGGATCAGATCTTCTCTATTTATGAGAATCAAAAGTCAGCTCGTGATGAGTGGGCCAACACGCTGTGGGCTAATCTTGATGTGTCAGTATTATCAGAGGGTATTGATGGCTTCATCAAACAGCTCAAGAGACTTCCCAGGGAAGTTAAGGCTCTACCACTATGCCACGTGCTGGAAGAGAAAATGAAGGAGTTTAAGAACTCTATCCCGCTTTTCTCTGATTTGAAAAACGAGGCTCTCAGGGAACGCCACTGGCAGAAGCTAATGGAAATGACCGGTATGAAGTTCGACCTAAACCCTGACACCTTCACCCTCCAGAACATGTTCGCTATGGAGCTACACAAGTTCCAGGATGTGATCGGTGACATCACAGCAAGTGCTACAAAGGAACTTGGGATCGAGAAAGGCATCAGCGAAGTGGCGGACACATGGGGTGCCATGAAATTCACCGTGTCTAAATTTATGAAAGGGACACAAGAGAGAGGCTTTATATTAGGCGCTGTGGATGAGATCCTGCAGATTCTGGATGATAATGCTATGAACCTGCAGAGTATGTCTGCCTCTCGGTTCGTTGGACCTTTCCTGGAAACTGTGAACAAGTGGGAGAAGAGTTTGTCACACATTGGTGAAGTAGTTGAGGTGTGGATGGTCGTGCAAAGAAAGTGGATGTATCTGGAAAGCATCTTCATTGGCGGTGATATCCGGGCACAGCTTCCAGAAGAAGCCAAGAAATTTGACGACATTGACAAAACGTTCAAAAAGATTATGAATGACACCGCCAAGAATCCAAAAGTGTTAGAAGCTTGTCACGCCGCCAGTCGCCTGGAAGAGCTTCAGATGTTAGTCGCTGGCTTGGAAAAGTGTCAAAAGAGTTTAAATGATTACTTGGACTCCAAACGAAACGCCTTCCCTAGGTTCTTCTTTATCTCCGATGATGAGCTGCTTTCTATTCTGGGAAGCCACGATCCACAGTGTGTGCAAGAGCACATGATCAAGATGTTCGATAACATTGCCAAGCTGCGTTTTGAAGAAGGGACTGGTCAAGAAATGTTGGCCACTGCCATGCTCAGTAGCGAAGCAGAAGTCATGGAGTTCAGGCAGCCGGTGGCAGCTGAGGGCCGCGTGGAGGACTGGATGACAAATGTACTGAATGAGATGAGAAGGACCAACAGACTCATTACCAAAGAAGCCATCTTTAAATATGGCGGCGATCTGCCCAGGTATTCCTTATAG

Transcript

BRAKERLUST00000031649

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8IVF4	Dynein axonemal heavy chain 10 OS=Homo sapiens OX=9606 GN=DNAH10 PE=1 SV=4
Q9SMH3	Dynein-1-alpha heavy chain, flagellar inner arm I1 complex OS=Chlamydomonas reinhardtii OX=3055 GN=DHC1 PE=1 SV=1
Q8TE73	Dynein axonemal heavy chain 5 OS=Homo sapiens OX=9606 GN=DNAH5 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000139 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF08393 all species →	DHC_N2	Dynein heavy chain, N-terminal region 2	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR042222 all species →	Homologous_superfamily	Dynein heavy chain, domain 2, N-terminal	Interproscan
IPR042228 all species →	Homologous_superfamily	Dynein heavy chain, linker, subdomain 3	Interproscan
IPR026983 all species →	Family	Dynein heavy chain	Interproscan
IPR013602 all species →	Domain	Dynein heavy chain, linker	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10676 all species →	DYNEIN HEAVY CHAIN FAMILY PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0007018 all species →	Biological Process	microtubule-based movement	Interproscan
GO:0008569 all species →	Molecular Function	minus-end-directed microtubule motor activity	Interproscan
GO:0030286 all species →	Cellular Component	dynein complex	Interproscan
GO:0045505 all species →	Molecular Function	dynein intermediate chain binding	Interproscan
GO:0051959 all species →	Molecular Function	dynein light intermediate chain binding	Interproscan
GO:0060294 all species →	Biological Process	cilium movement involved in cell motility	Interproscan
GO:0097729 all species →	Cellular Component	9+2 motile cilium	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for BRAKERLUSP00000031649.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Blastomussa wellsi tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Blastomussa wellsi, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →