Gene detail

Detailed information of BRAKERNUSP00000002014.1 in Montipora cactus

Genomic Location: BLFO01000105.1:1017527...1039086
NR annotation: KAJ7381020.1, hypothetical protein OS493_004615 [Desmophyllum pertusum]
Species Montipora cactus · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

BRAKERNUST00000002014

ATGGAGTATGCCCCTGTGTGTGGGTCAGATGGGAAAACGTATTCTAATGACTGTGTTCTAAACGCAACTGCCTGTGAAAGAAGCCAGAACATTACTTTGGTAAGCCAAGGCAAATGCAACGAGGATGTCGAAAATCCTTGTGATGAACCAGCACTGTGTTCACATCGTCATCATCAATGTCAACTTTTGGATGCAACAGCAATATGCATGTGTCCAATGACTATTCCAGCAAACTTAGATCCAGTTTGTGGTTCTGATGGTGAGACGTATCCCAATGCAGCGGCACTTGAAAGCATGAGTTGTCTGGCAAACAGAATCGTGGACTTACAATATAGGGGCGCTTGCATTGTTCCCACCGATCCTTGTGATACCTCGATTTGCAGTCATCCCCTTCATCGCTGCAAGGTTGTACAAGGCTTAGCAACCTGTGTCTGTATGGAAGCTTGCCCATTGATCATGATGCCCGTCTGTGGATCTGATGGCTATAGCTACCCAAATAAATGCACGCTTGAGGTTGAGGCATGCATTAGTGGAAAGAACCTTACAGTTGCAGCTATGGGAGAGTGTGACAAATGTACAAAAAAGATTTGTCCTAACTCAAGGCAGTATTGCAGAGTGGTTAACGACACAGCAATTTGTGAGTGCAACGAAATCTGCACTTTTGACTGGAGGCCTGTCTGTGGATCTGATGGTACAACGTATTCCAACAACTGCAGTTTAGAGGCAGAAGCTTGTAAAACAGGAAAAATGATAACAGTGATAAAGCAAGGAGAATGTGGTGCCGGGCAAAGTCAGTGTCCAAAATTGAGCCCCACTCCATTGTGTGAAGAGGTCACTGGCTGCCAATCTGATAATGAATGTGTTCCTGGGCAGATTTGTTGCCTCCAAAAGAATTGCACAAGGAAATGTGTCGTTGCAAATGCGGTTCCTCCACCGTCTCAGTTGCGGACCTGCCCTATTCTTGACCCAACCCCCATGTGCCAACTGCCACCAGATGCTGAGCCTAACTGTTTTACAGGGGGACCTGCGTGTCCTTCTGGGCAAGCTTGTTGTCTTGATGTAGACTGTAACCACAAGTGTGTAAACCCAGCCTTGCCTGACGGATCTAGACACGGTGAATGTCCAGCTCTTGATCCAGTGCAAGAATGTGTATCGATAACTGGCTGTGACGCAGACAAGAGATGCGCTCTTGGAGAAAAATGTTGCCTTCAATCAGACTGCACTAAAAAATGCATTAAGACTGATGTACCACCATCCCATCCACCACTTCTTAAACAGCTAACTTGCCCTGTTCTTGATCCAACTCCCATGTGCGGACTGTCACCAAAGGCACCTAATTGCTTTACGGGAGGTCCAAAGTGCCCAACTGGACAAGCTTGTTGTCTTGATTCCGATTGCATTCACAAGTGTGTCGAGCCTGCCCTCCCCAACGGTTCAAGACCAGGAGAATGTCCAGCACTAAATACAATGCCAACATGTGTATCTATAACTGGCTGTGACGCAGACGAAAGATGTTCTCTTGGGAAAAGATGCTGCCTTCTCGCAAACTGCACCAAGACATGTATCAAGATTAACTTTCCAGCACACTTACAATCTCCAGTCCCTCTGAGAGCTCTGACGCCAGTTTTTGAGTACAAACACGGTACACCAGTAAAACCAACTTGTGATCCAGCATGTCATCGATATGCGAAGTGCATTGAAATCCACACAACTGGGGAGTACAAGTGCTCATGCCCTAGGCCATGTTCAAGGATATACAAGCCTGTCTGTGGCACAGATGGAGTAACATATAGCAATGAATGTATGCTCATGTATTTAGTGTGCGAGGACGGTACTAATGTCAGCGTCAAACACCCTGGAAAGTGTACTGAGAAAGAAGAGATGGAGAGGAAATCAAAGTTAGGAATGTCTTCTTGTCGGAAGAGCACCAAGGTCTATGAAGTGGACGCATCCAAGAGAGGAGGAACTGTTCATCAAGAGCTGACTGATAGGAAGGCGACTGCAGAGCAGAGAGATCGTCCCAAGGGGGACAAATTCATGGCTGAACTGCAAGCGATCCGGTCAGAACAAGCCACTTGA

Transcript

BRAKERNUST00000002014

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O00468	Agrin OS=Homo sapiens OX=9606 GN=AGRN PE=1 SV=6
P31696	Agrin OS=Gallus gallus OX=9031 GN=AGRN PE=1 SV=3
A2ASQ1	Agrin OS=Mus musculus OX=10090 GN=Agrn PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000507 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00095 all species →	WAP	WAP-type (Whey Acidic Protein) 'four-disulfide core'	Domain	Interproscan
PF00050 all species →	Kazal_1	Kazal-type serine protease inhibitor domain	Domain	Interproscan
PF07648 all species →	Kazal_2	Kazal-type serine protease inhibitor domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR008197 all species →	Domain	WAP-type 'four-disulfide core' domain	Interproscan
IPR002350 all species →	Domain	Kazal domain	Interproscan
IPR036058 all species →	Homologous_superfamily	Kazal domain superfamily	Interproscan
IPR050653 all species →	Family	Protease Inhibitors and Growth Factor Antagonists	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10913 all species →	FOLLISTATIN-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005576 all species →	Cellular Component	extracellular region	Interproscan
GO:0030414 all species →	Molecular Function	peptidase inhibitor activity	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005615 all species →	Cellular Component	extracellular space	Interproscan
GO:0007275 all species →	Biological Process	multicellular organism development	Interproscan
GO:0030154 all species →	Biological Process	cell differentiation	Interproscan
GO:0030510 all species →	Biological Process	regulation of BMP signaling pathway	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for BRAKERNUSP00000002014.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora cactus tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora cactus, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →