Gene detail

Detailed information of Csp0G040090 in Chrysogorgia sp. JL179-B06

Genomic Location: Contig00099:113750...117742
NR annotation: no NCBI-NR hit recorded
Species Chrysogorgia sp. JL179-B06 · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Csp0G040090

ATGGAGAAATATGCAAATGAATTTGAGGGTGTTTTGTCTTTGGCAAATAGACCATTTCAAGAGGCTAAAGTGAACAGCAGGACAATTTGTTCAGAGTGTTTTAAGAGTAATGGCGAAATTAAATTCCTCTTAGAAGACGCGGGATTAACGCAGCATTTCCGAATAAAGCATGGTCACTTGTTACTAGATGACAGCATTTTTAAGCATTGTAAAATGCTTTTTCAAGATCTTCACGGTCAGGAAACCGTCAAAATGTTGGAGCAACTATCCGAAATACGACTTAAGACGAATAGTGCTAGTGTTGCAATTGGTTCAGAAACACTCCAAGAATTTTGTGTTATACACATTGATACATATGAAAGCATGGATGAATCAATGCAGACCAGCCCGGCCATGAGGATTGTTGGAAACAGCAGACGAGAAGCAGCAAAATTGTATGGTTTGGTGCTCAAAGCATTTGGCCTTTTGAAGCATTTGGGAGGGATTCCTTGCCAGGTTCGAGTTTTAGACAAAGGAAATGATAATGATCATCCTGGCCAGTGTTTCAAGTTGTGGAATGCAGGGGATAAAATTTATGTTGAATGTTTTATCACGCCCAAAAGGTATTTGGTGCTCCCAAGACAGCACACCCCATGGATGACGACACAAGAGCAGTCACATGGTATTTCACAGGTTTCTTTGGAAAGTACTTGTACAACACCATTACAAGTTCTTCAAAAAGTTTTTGGTCACCATGATTTCAGGCCTGGCCAAAAAGAAGCAATCATGCATTTAATTTCTGGACAAGATACTATTGTTCTTATTCCCACTGGAGGTGGAAAAACTGTGACATATGCATTGCCATGTATTATGGTTCCTGGTGTGGCTATTGTGGTATCACCGCTTATAATGCTGATGTGTGACCAAGTTGCAAGGTTGCAAGGATATGGTATAAACACATGTTACTATAACACTATGCAGAGTGACAGTGAAAGACAAAACATCTTACACAATTTGAAACAGCCCAACTGTCAGTACCAATTCTTGTTTGTTAGTCCAGAAGCTATTGTAACTGAACAGTTCCAAAGTTGTTTAGACAAGCTCAACAGTGATAGAAGATTGAGCTTTTTTATTATTGACGAAGCACACTGTATTGACACTTGGGGAAATGAATTCAGACCAGCTTATCAGCAATTAGGTATTTTACGTAAATACAATGTGCCAGTCACTGCTCTTACTGGCACAGCAACAAATCAAACCCTGGATTCCATTAAGGCAACCCTGCAGATGAACAACCCACAGATTGTGAGAATGCCATGCAGAAGGGATAATTTGGTTTATTCAGTTATTGATAAGAAAGAGACTAATGCTAAGCAGCAGGTATGCCAAATTATTGAAGATGATTATCCAGATGCATGTGGCATAATATACTGTGCAACCCAATCAAACACAGTTGAAATGGCATTTGTCTTAAAGCAACGTGGTGTGACAGCTACATTCTACCATGCTGGGGTGGAAAGTGGCGATAAAATGAGAAATGCTTCCCTTTGGTTAGGTGATATGGTTAAAGTCATGTGCTGCACAAATGCCTTTGGAATGGGGATTGATAAGAGAGATGTACGATTTGTGATACATCTGTCAATGCCTTCATCCCTAGAAGATTATGTCCAGGAATCAGGAAGGGGAGGCCGTGATGGTGCCAGCTGTTCTTGCCTATTGCTGTTCCGGTTTGGAGACAGGATGTTCCACCTTCGCAACATATCAAGAATGGCTTTGGAGCAAGTGAAAGAGGATAAGCTCCATCTATTAAATTCACTGACACATTTCTGCATGGAACATTCAGTTTGCCGACAGCAAATCGTTGCAAAATATTTTGCAGAAGAGGAGGGCGAACCATGCAAGTTATGTGATGTTTGTCAAAAAGGAGTAATCCACGAGGTCAAGGATTATACCCAAGAAGCAAAAAATGTGATGGAATGTTTGACAAATTTGGTTTCTATCCAGTCCAAAGTCAAAATCAGTCACCTGGTCATGACTTACATGGGTTCCAAAGCAAAGGAGATTACTGGCAATGGCTTTCATACTGTTCCACAGTATGGAAAGGGTAAAATCAATTTTCGAAACAGTTCAACTCTGACAAAATTCGTACAGCTTATGATTTTTGAAGGATTTTTGAAGGAGAACTTACGTAACATAGAAGATAGAATTTCACTAACATACCTAACACTTGGTAATGTTACTAATTTATTTAATAATACCATTTCAATCAATTTTACTCATTCCTGA

Transcript

Csp0G040090

Protein

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000292 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00271 all species →	Helicase_C	Helicase conserved C-terminal domain	Domain	Interproscan
PF00270 all species →	DEAD	DEAD/DEAH box helicase	Domain	Interproscan
PF16124 all species →	RecQ_Zn_bind	RecQ zinc-binding	Domain	Interproscan
PF09382 all species →	RQC	RQC domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001650 all species →	Domain	Helicase, C-terminal domain-like	Interproscan
IPR011545 all species →	Domain	DEAD/DEAH box helicase domain	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR004589 all species →	Family	DNA helicase, ATP-dependent, RecQ type	Interproscan
IPR018982 all species →	Domain	RQC domain	Interproscan
IPR032284 all species →	Domain	ATP-dependent DNA helicase RecQ, zinc-binding domain	Interproscan
IPR014001 all species →	Domain	Helicase superfamily 1/2, ATP-binding domain	Interproscan
IPR036388 all species →	Homologous_superfamily	Winged helix-like DNA-binding domain superfamily	Interproscan
IPR036390 all species →	Homologous_superfamily	Winged helix DNA-binding domain superfamily	Interproscan
IPR002464 all species →	Conserved_site	DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13710 all species →	DNA HELICASE RECQ FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000724 all species →	Biological Process	double-strand break repair via homologous recombination	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005694 all species →	Cellular Component	chromosome	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0006268 all species →	Biological Process	DNA unwinding involved in DNA replication	Interproscan
GO:0006281 all species →	Biological Process	DNA repair	Interproscan
GO:0006310 all species →	Biological Process	DNA recombination	Interproscan
GO:0009378 all species →	Molecular Function	four-way junction helicase activity	Interproscan
GO:0032508 all species →	Biological Process	DNA duplex unwinding	Interproscan
GO:0043138 all species →	Molecular Function	3'-5' DNA helicase activity	Interproscan
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0004386 all species →	Molecular Function	helicase activity	Interproscan
GO:0006260 all species →	Biological Process	DNA replication	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K10899	RECQL; ATP-dependent DNA helicase Q1	EC:5.6.2.4	DNA repair and recombination proteins	ko03400	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Chrysogorgia sp. JL179-B06 tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Chrysogorgia sp. JL179-B06, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →