Gene detail

Detailed information of Csp0G287560 in Chrysogorgia sp. JL179-B06

Genomic Location: Contig00529:2827875...2858055
NR annotation: no NCBI-NR hit recorded
Species Chrysogorgia sp. JL179-B06 · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Csp0G287560

ATGGATTTAGCTCACACGAGAAGCGTCGAACAAGTGTTGGACTCTTTCGGAGTTCAGGAATCGTCGGGTCTCTGTTTGGATGAAGTGAAGTTGAGCCAAGAGAAATATGGGCCAAACGAAATGCCCGTTGAAGAAGGGACGCCACTGTGGAAATTGGTTTTGGAGCAGTTCGACGACCTGCTCATAAAAATCCTACTGCTCGCCGCCGTTGTGTCTTTCGTGTTGGCTCTTTTCGAGGACGCCGAAGATAGGACGACAGCGTTTGTCGAACCGTTCGTTATATTGGTTATCCTTATTTTGAACGCAATAATCGGCGTTTGGCAGGAACTGAATGCTGAAAGTGCCATTGAAGCTCTTAAAGAATATGAACCTGAAATAGCAAAGGTGGTGAGACAAAACAAAAGTGGCATGCAGAAAATCAAAGCTAGAGAACTGGTGCCTGGTGATATAGTCCATGTATCAGTTGGGGACAAAGTGCCTGCTGATATTCGTGTCACTTCAGTACTGTCTATTACATTGCGAATAGATCAATCTATTTTAACTGGAGAAAGTATTAGTGTTTTAAAGCATACAAATGTAATTCCCGATGAAAGAGCTGTAAATCAAGACAAAACTAATATGTTATTTTCGGGTACAAACGTTGCATCTGGCCGTGCTATAGGAGTTGTCGTTGGTATTGGCTGCAACACTCAGATAGGGAAGATCAGAGATGAAATGGTTGAGACTACATCTGAAAAGACTCCGTTGCAATGCAAACTAGATGAATTTGGTGAACAATTGTCCAAGATAATTACCCTGATCTGTATTGCAGTATGGGCTATCAACATTGGCCATTTCAGCGATCCTGTTCATGGTGGTTCGTGGGTGAAGGGTGCTGTGTACTATTTCAAAATTGCAGTTGCCTTGGCTGTGGCAGCAATCCCTGAAGGACTGCCAGCTGTAATTACAACATGCCTTGCATTGGGGACTAGAAGAATGGCGAAGAAAAATGCAATTGTTCGTAGTTTACCTTCTGTGGAAACACTTGGATGTACTTCGGTCATCTGTTCTGATAAAACAGGAACACTTACTACTAATCAGATGTCAGTTTGCAAGTTTTTTATTTTAGATCAACTAGAGGGCGAAAAACCGACTTTCAATCATTTCGATGTCAGTGGAACAACATATGCCCCTGAAGGAAAAGTGACGCTAAACGGTGAAGAAGTAGATGTCCAGGATTTTGATGCCATTCAGGAGTTGGCTGTCATATGTGCTCTCTGTAATGATTCTGGCGTGGATTACAATGAGAGCAAGAAAGTCTACGAGAAAGTTGGTGAAGCCACTGAAACAGCTTTAGTTGTACTTGTGGAGAAGTTGAATGTGTTTGGACTGGACTTAGAAGGCAAAGATGCTCATATCCTGGCGAACGCGTGTAACACCGAGATCTTTAAACATTTCTCGAAGGAATTCACGTTCGAGTTTTCGCGAGACCGCAAGTCGATGAGTTCCTACTGCGTACCAAAGGATGGTCTACGGGAAATGTTCTCGGGCAGCGGACCCAAGATGTTTGTCAAGGGTGCACCAGAAAGTGTTTTAGAGAGATGTGATTTCGTGCGAATTGGCAGAGAAACCATTCCTCTCACAGAAGCTATGAAGAGTGAAATCATGACGAATGTTCAAGTGTACGGAACCGGGGAGAACACGTTGAGATGTCTCGCTTTGGCCACCGTCGATAAACCATTGCCGAAAGAACAGATGGATTTGGAGACTCGTGATGTAACGAAATACGAGAGTGGCATGACATTTGTTGGTGTTGTTGGTATGTTGGATCCTCCTAGAGACGAGGTCATTGATTCTATTCAAAGATGTCGTCACTCTGGAATTCAAGTTATTGTTATCACTGGTGATAACAAGGCTACAGCAGAAGCGATCTGCAGGAGAATCGGTGTTTTTGGTCCGAAAGAAGATACAACTGGTCTATCGTACTCTGGCCGTGAATTCGACGATCTTAGCGAAGAAGAACAGAGGGAAGCATGCAGGAGAGCAAGGTTGTTCTCGCGAGTTGAGCCATCCCACAAAAGTCGCATCGTGGGATATCTCCAAGACGACGGCCATGTTGCCGCCATGACGGGTGACGGAGTCAATGATGCCCCTGCTCTTAAGAAAGCGGAAATTGGTGTTGCCATGGGATCTGGTACTGCTGTCGCCAAGACTGCTTCCGAGATGGTTCTTGCTGATGACAATTTCGCCACGATCGTCGCAGCCGTCGAAGAGGGTCGCGCCATTTATAACAACACCAAACAATTCATTCGCTATCTTATCTCGTCAAACATTGGAGAGGTGGTCAGCATCTTCCTCACAGCAGCGCTGGGCATGCCCGAGGCTTTGATTCCCGTGCAATTGTTGTGGGTGAACTTAATGACGGACGGCCCACCAGCCACTGCCTTGAGTTTCAATCCACCAGATGTTGACATCATGGAGAAACCACCAAGGAAGTCGAAAGAACCCCTCATCAACGGCTGGTTATTTTGTAGATATCTTATTATAGGAGTTTATGTTGGTGCAGCCACGGTGGGAGCGTCAGCCTGGTGGTTTATGTACTATGAAGGTGGACCTGAACTTACCTACTATCAAATGACTCACCACATGCAGTGTACCTTAGACATAGACGCTTTTCAAGGCGTAAATTGTTCAATATTCACCGACCTTCATCCAATGACCATGGCATTGTCGGTATTAGTTACAATTGAAATGTTCAACGCTCTGAATAGTTTGAGCGAGAACCAGAGCTTGTTGACAATGCCTCCCTGGCAGAATCCGTCTTTGGTCACGGCGATCGCCGCCTCTTTTCTGATGCATTTCGTAATTCTTTATTTCAAATTTACTAATGCTATTTTCCGCATAACACCTCTCAACATGATCGAGTGGACAATGGTCCTAAAACTGTCATTCCCCGTCATACTACTTGATGAAATACTCAAATTCGCGTCCAGAAGGTTAATTGATTCTGACCACTCGAAAGTAAAGACCGACTAA

Transcript

Csp0G287560

Protein

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001607 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00702 all species →	Hydrolase	haloacid dehalogenase-like hydrolase	Domain	Interproscan
PF13246 all species →	Cation_ATPase	Cation transport ATPase (P-type)	Family	Interproscan
PF00690 all species →	Cation_ATPase_N	Cation transporter/ATPase, N-terminus	Domain	Interproscan
PF00122 all species →	E1-E2_ATPase	E1-E2 ATPase	Family	Interproscan
PF00689 all species →	Cation_ATPase_C	Cation transporting ATPase, C-terminus	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR004014 all species →	Domain	Cation-transporting P-type ATPase, N-terminal	Interproscan
IPR001757 all species →	Family	P-type ATPase	Interproscan
IPR044492 all species →	Domain	P-type ATPase, haloacid dehalogenase domain	Interproscan
IPR023214 all species →	Homologous_superfamily	HAD superfamily	Interproscan
IPR005782 all species →	Family	P-type ATPase, subfamily IIA, SERCA-type	Interproscan
IPR018303 all species →	PTM	P-type ATPase, phosphorylation site	Interproscan
IPR006068 all species →	Domain	Cation-transporting P-type ATPase, C-terminal	Interproscan
IPR023299 all species →	Homologous_superfamily	P-type ATPase, cytoplasmic domain N	Interproscan
IPR008250 all species →	Homologous_superfamily	P-type ATPase, A domain superfamily	Interproscan
IPR023298 all species →	Homologous_superfamily	P-type ATPase, transmembrane domain superfamily	Interproscan
IPR036412 all species →	Homologous_superfamily	HAD-like superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR42861 all species →	CALCIUM-TRANSPORTING ATPASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005215 all species →	Molecular Function	transporter activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan
GO:0005388 all species →	Molecular Function	P-type calcium transporter activity	Interproscan
GO:0006816 all species →	Biological Process	calcium ion transport	Interproscan
GO:0000166 all species →	Molecular Function	nucleotide binding	Interproscan
GO:0006874 all species →	Biological Process	intracellular calcium ion homeostasis	Interproscan
GO:0015662 all species →	Molecular Function	P-type ion transporter activity	Interproscan
GO:0016021 all species →	Cellular Component	membrane	Interproscan
GO:0034220 all species →	Biological Process	monoatomic ion transmembrane transport	Interproscan
GO:0070588 all species →	Biological Process	calcium ion transmembrane transport	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K05853	ATP2A; P-type Ca2+ transporter type 2A	EC:7.2.2.10	Diabetic cardiomyopathy	ko05415	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Chrysogorgia sp. JL179-B06 tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Chrysogorgia sp. JL179-B06, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →