Gene detail

Detailed information of Csp0G295040 in Chrysogorgia sp. JL179-B06

Genomic Location: Contig00545:2597316...2671213
NR annotation: no NCBI-NR hit recorded
Species Chrysogorgia sp. JL179-B06 · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Csp0G295040

ATGAGCACAGGAGGTGTTGGATTGAGCGCAGGAGGTGTTGGATTAAGCACAGGAGGTTTTGGATTGAGCGCAGGAGGCGTCGGACTGAGCACAAGAACCTGCGCTGCAAACAAATCCGAAACCCAGGTTGAGTACGTCTGCCGTCTGCGTAATAGCGGCGGAATCAAAAGCCCGCAACAAACTTTCAAAAACATATCAATCAATGTCAAACAGACCATCTTCGTTGTTTACTCTACTTGTTATGACATTAGTGGATCAATCATTGATGATCGGCAGATATCATATGCCCGCAATTTTAGGCGTAAACACCATAGATCGATTCAGACTAGTTGTCGGCGCCTCACGTATTACCAGGGTATCTGTCCATGGCAGCTTTCACTACATTATTACAGCGGCCCAAGGCCGCTTCTGAGACTGAGGGAAAATATTTTTCCAGTACGGACCGACCAAAACGGTTATTCACTCGCACATGGAGATTTTTTCACTGTTGGAAAATCGGCTTTTGCTTTTGGTGCCCCACGATATCAGACAAGGGGTGCAGATGGCTCTTACTTCGGAATGTCAATGTGTGCTGATGACTTTGATGGTGATAAGATCTCAGAGATTGTTGTTGCAGCTCCTTATCATACTGAATCCCTAAGCGAGCCAGGAATTGGCATTGTTTATGTGTATAGTAGTAAGAATAATTTCAAGAAACCTACCCATGTTTTGAAAGCAGAGAAATCTGAAGCTCATGCCCTTTATGGACGATGCGTTGCCTCTCTTGGAGATATGGATCAAGATGGATATAATGATTTAGGTGTTGGTGCGCCATATGAAGACACTGGAGGAGCTGTTTATATCTACCAAGGCTCTAGCAGTGGACTATATACTGTACCAGTTCAGATTATTCGTGCATCACAACTGCCCAACCAACTTAAAACATTTGGTTGGTCCGTTCGAGGACATGTGGATTTGGATGAAAATGGATATCCAGATCTTGTTGTCGGCGCTTATGCAAGTAACTCCATTGTGATTTTGAGATCTGTTCCAGTGGTTGATGTCACCTCGTCTTATGTATTATCACCAAAATCCATTGATGTGTCGAACAAAAGCTGTACTGTGTCTGTACCCAATCAGGGAGATATTAAGACTGTGTGTTTTGCTGTTGAAATATTTGCATTCTATAAAGACAGAGCGGAAATGATGAAGAACAACATTGACTTGTCATTTACGTTGGAAGCTGACACGTTGGTGACAGATAAGAAAAAAAGAAGAGTTGTTTTCGAACGATCACATTCATCTCTCTTGGAAATCTCAAACAAAGAGGTGCAAAATGAAAAGAGAAGCAAAATTGCCAAAGAAATGGCATATTTACGAATCGACTTATGTCCAGACTGTGAAGACAAAATCCGTGCATTTCCTGATATCCAACTCAAGTTAACAGCCAAGCTTCCAAAACGCCCCAAACCACCTTCACCTCCCACATCAGGAACGCCACCATCATTAGAAAAATATTTTCAACTTCCTTTTTATACGCAAAATGTTGACTTTAAAAATACAACTCTTCCTATCAAACGTGCATGTGACCCTTGTAAACCCAACTTAAAGATAACGAACATTGGAACTACGACAATTTCTGTGAAAGCTCAAAGTGTACACCTTAAAGTTAAAATCAGCAACACTGAAGAACGAGCGTATGCTGTTGTATTTAAAATTGTCCTTCCACCAAAACTTAGTTTCACTCAGTGTGTAAATTTTGAAAATTTAAAGTGTTTTAGTGTTGCTAAATGCCAAGAAACAAAAAACGGTACAGAAATTACATGTGGTCTTGAAAGTATTGCTGACCAGCCTAAGGAATTTGCAATAAAGCTGAACACAAGTCTAGCCTCCCAGTCACTTGAAATCTACAAAGTTGTGATGAACGTATCCAGTGGAAATGTAGAGGAAGCAAATTTGCTGGGAGATAATACTTTACAACTGGAGCTCTCAGTGGAGTCTAAAGCTGACATTGGTGTTCGTCAATCCGGATCAACAGAGTCCAGATATTACGGAGGGAGTGTTCGTGGCCAATTCTCTATGACACGTGAGGAACAAATTGGTTTACCTTTGGAACACAGATACGTTGTTGAAAACAAAGGACCAGATATTGTACCTGAAGTAAACATAACTGTTGAATGGCCTTACGAAGCTGAAAGTGGAAAACACTTGCTTTATTTACTTGAGATTAAGACATATTCTAGGATGACATGCTTTCCAGAGCCGGAATGGGTAAATCCATTGGCCAAACAGTTCAAGAAAGAAGTTTTAAAAACAACTACTATCAAAAGAATACGTCGAAATGTAGATGATGATGCGACAGATGAAACATCATCACCAGCTGTAGACGAGCAAGTGAGAAAAGGATCTAGCTCTAAAGTTATTTTGGATTGTCGAAACAAGACGGCTAGGTGTCATAATATACTTTGCAGTGTAAAAGATCTCGATGCTCAAGAAAGCGTTTCTGTGACTTTTAAATCAAGAATATGGAATGGGACTTTATTGGAGGATTATAAAGGTCGAGATGTTGTCGTAATTTCTTATGCTCGCGTTGATAGTGTGACTTCTTATATAACTGACCTTGACCAAACCAACCATCTTGCTGAAGCAAGTACGAGTTTCTTCCCCGCTTCACCCAAGACAACAAAGAAAGGTATCGCTCTCTGGATCATAGTGGTATCCGCCATAGCTGGAGTGGTTTTGCTCGTCCTTCTAATAGTTATCTTCAAAATGTGTGGATTCTTTAAGAGGATGGACACTACCCGGTACGATCCCGTAGATTCGAGCTAA

Transcript

Csp0G295040

Protein

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000596 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01839 all species →	FG-GAP	FG-GAP repeat	Repeat	Interproscan
PF08441 all species →	Integrin_A_Ig_1	Integrin alpha Ig-like domain 1	Domain	Interproscan
PF20805 all species →	Integrin_A_Ig_2	Integrin alpha Ig-like domain 2	Domain	Interproscan
PF20806 all species →	Integrin_A_Ig_3	Integrin alpha Ig-like domain 3	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR013517 all species →	Repeat	FG-GAP repeat	Interproscan
IPR032695 all species →	Homologous_superfamily	Integrin domain superfamily	Interproscan
IPR028994 all species →	Homologous_superfamily	Integrin alpha, N-terminal	Interproscan
IPR013519 all species →	Repeat	Integrin alpha beta-propellor	Interproscan
IPR013649 all species →	Domain	Integrin alpha, first immunoglubulin-like domain	Interproscan
IPR048285 all species →	Domain	Integrin alpha, second immunoglobulin-like domain	Interproscan
IPR000413 all species →	Family	Integrin alpha chain	Interproscan
IPR048286 all species →	Domain	Integrin alpha, third immunoglobulin-like domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23220 all species →	INTEGRIN ALPHA	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005178 all species →	Molecular Function	integrin binding	Interproscan
GO:0007160 all species →	Biological Process	cell-matrix adhesion	Interproscan
GO:0007229 all species →	Biological Process	integrin-mediated signaling pathway	Interproscan
GO:0008305 all species →	Cellular Component	integrin complex	Interproscan
GO:0009897 all species →	Cellular Component	external side of plasma membrane	Interproscan
GO:0033627 all species →	Biological Process	cell adhesion mediated by integrin	Interproscan
GO:0098609 all species →	Biological Process	cell-cell adhesion	Interproscan
GO:0007155 all species →	Biological Process	cell adhesion	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for Csp0G295040.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Chrysogorgia sp. JL179-B06 tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Chrysogorgia sp. JL179-B06, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →