Gene detail

Detailed information of Csp0G476360 in Chrysogorgia sp. JL179-B06

Genomic Location: Contig00854:16484618...16517142
NR annotation: no NCBI-NR hit recorded
Species Chrysogorgia sp. JL179-B06 · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Csp0G476360

ATGGCGTCGGAACAAAGGTCGTCTCCTCACACTTTCTCAAGAAGACAACAAGAGCGCAGTGGTGAAAATGGCCATGTTGCGCTGTCACAGCGTCTAAGTCGAGCTGAATACGACGAACTTCGCTCGAATGGAACTGGTGGGAGCTCGAAGATATCAGAGCCTTCTTCGGTTATCGAAGCAGGTACATCAGACATGCCAAATGAAGAGGAGATAGAAAAACGTTTTGGCAATCTTTTGGAAAAATTAACCCTTGATCCAGAACAAGTGACTGATTTACAACGACATCCAATTCAACACAAGTGGAAGTTAATTCAGGCAAAGGAAATGGTAGAACCCAAACACTCATCTCAGTTCTATGTGACCCAGCTTAGACGACACATGGATGACACCCTACTGCAATATGCCAAACCACCAAAGAAGTTAGTCAAGGATTTAGAACCAATCGAGGTCATCTTAAGATCCTTAGAAGTGGATGTAAGAACACATCCAAACACTACAACTTGCCAAATCTTACTATCATCTTTCAAAGATCTTCCCATGATCTTACAAGAACTTGACAAGATCTTCCCACTATCTTACAAGAACTTACCAAGATCTTACTATCATCTTACATCATTCATATCTTCCCATATGATCTTACAAGAACTTGCCAAGATCTTACTATCATCTTATCTTCCCATGATCTTACAAGAACTTGACAAGATCTTACTATCATCTTGCAAAGATCTTCCCATGATCTTACAAGAACTTGACAAGATCTTACTATCATCTTATCTGGGCAGGATCTTGGCAGATCATATGGCAAGATCTTGTTCTTATTGTAAGATCTTGGCAAAGTCATGGAAAGATCTTGATAAGATCTTGGCACGATCTAGGCGATATGAACATATGTGCTTGATGTGTCTGAAGGCATTAATGAAAAATAAGTTTGGTTTCAAGTCTGTCATGGCCGTTGAGCACACTCTTAGAAATGTCGTAATGTGTCTTCAAATTGACAACATCAAGACAAAAATTCTTGCCATCAAGCTCCTCTATGCTGCCTGCGCTGATGACAAGTACCACAACAATGTTATTGAAGCACTGGAGTATTTTAGAGCAAGCACTAAAGAACATCAAATGTTCAAAACACTTGTCAGTTATCTTCTTCTTGAACCAGTTCAACCTGGACTACAGGCGGTAACATTGGCATTATTGAATGCTGTAGTGAACAACTCTCCTTCGTACAATGAAAGGGTATTTCACCAACAACAGATTTGTGTTGCAGGATTCAGTGAACAGCGCTTAGAAAAGGTCTTGGAAGGCCTGGATGCCTCACCGGTGAGGGATGAACTTCAAATATGGAGAGAAAATTTCGTTAACATTCAAGACCTAATGGATGAATATGTACAGCTTAAAGAAAGATCAAAACTACTGCGCGATGAGGTTGACCTTTTGCAAGGAAAGTTAGAGGATGTACAACGTGAGAAAAACGATGTTGAAAGACAAAAATCAGAATTTGAAGAAAAAGCAGAGAATTTTAGATTTCGAGCGATAGAACTTCAAACAGCCCTGGAAAAAGTTATGAAATCTCACAGCAAAGATGGAATTGATGCTTCCTTATTGGAACCATTAAACTCTAACGCTGCTCCCCCAGCTCCGCCTGCACCACCACCTCCACCACCACCTCCATTTCCAGGTTCCGGAGTTCCCGCTCCGCCGCCGCCTCCCCCTGGAATGAAAGGAGCTATTGCAGTGACAAAACGCAAAGTGTACAGTAAAAAAAAGTTGCCAATGTTAAACTGGTCACCAGTTACGTGTACTGATAAAACAATATTTGAGTCCATGGATGATGAAAAGTTGGCCTTGCAGCTTGACCTAACGAATTTTGAATCGGTCTTTGAACTGAAAAGCAACGAGATGAGCGAAGAAGTCAGGCTTCGCAAAGAGGCTGCTTTGAAGAAGCTCGCTGAACAAATCACTGTAATAGAATCGAATAGAGCAAGGAATTTAGTAATCGCAAAAAGGAGAATTGGATTTTCTCCAAAGTTTATTCAGCAATACATAAACAACAGTGATCTGTCTGAGCTGCGTCCAGAACATGCGGAACTGTTGTTAAAGTTCGTTCCCACGAAAGAAGAGTTAGCAGGTCTTGCCAAACATGCAGAGAACTACACTAAAATGGCTGAAGCAGAACAGTTCATGTTTGAGTTGGCAAAAGTTCAACGATATGAAGCAAAGCTCAGTGTCCTGACTTTCATTGGCGTCTTTGACGAGGTCATGTCGACAGTTGTACCGAAAGTAGACGCTGTGTCAAGAGCTTCTTTGAGTGTTTTAAACAATAAAAAACTGAAGAAAATATTCGAGATTATCCTTGCTTTTGGTAACTACATGAACGGTGGAAGAAGAAAAGCTGCCGCTGGATTTAAATTAGAGTCATTGTATAAGCTTCCAGATATCCGCTCAACAGATCGTAAAATGTCGCTGCTCAACTACGTCGTCCACACAGTGAAAACACATTTTCCAGACCTCCGCTCGTTCGCCCAGGATCTCTGCTTGCAAGAAGCTACACAAGTTTCCAAGCAGACGCTCAATGCTGACATCCAAAGTCTGAAGAAAGGTATTGATTTAACGAAAACAGAGAGAGACAAACAGCCAAACAACTTTGTTTTATTTAGTTTTTACAATCGAGCGTTCCGGAAAGTTCAAAAAGTGAGTGAAAAATATCGTAAAATGGACGAAACCTACATTGAGGTGTGTCAAATGTTTGGAGAAGACGGCAAGAAAATCGAACCTTCTGAATTCTTTAAAATTTTGCACGACTTCGTCTCTACGTACTTTCAAGCTGAAAAAGAGAATGATGAGCGTAAAAGGCAAGAGGAAGCCAAAAGACAAGCAGAGATAATGATGAGCAACCAGCGAAACAACGAGAAAAATCTACCATCAGTGGAAACAGCCTGGAGTTACACGAGGGACTCACCAGAATATGGCGATGAAGATGATGATTACAGTACATCAGGATCAGATGGTTCTGACTCCACATAA

Transcript

Csp0G476360

Protein

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002828 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF06371 all species →	Drf_GBD	Diaphanous GTPase-binding Domain	Repeat	Interproscan
PF02181 all species →	FH2	Formin Homology 2 Domain	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR015425 all species →	Domain	Formin, FH2 domain	Interproscan
IPR014768 all species →	Domain	Rho GTPase-binding/formin homology 3 (GBD/FH3) domain	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan
IPR010473 all species →	Domain	Formin, GTPase-binding domain	Interproscan
IPR043592 all species →	Family	Formin-like protein, animal	Interproscan
IPR042201 all species →	Homologous_superfamily	Formin, FH2 domain superfamily	Interproscan
IPR010472 all species →	Domain	Formin, FH3 domain	Interproscan
IPR011989 all species →	Homologous_superfamily	Armadillo-like helical	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45857 all species →	FORMIN-LIKE PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003779 all species →	Molecular Function	actin binding	Interproscan
GO:0030036 all species →	Biological Process	actin cytoskeleton organization	Interproscan
GO:0031267 all species →	Molecular Function	small GTPase binding	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0007010 all species →	Biological Process	cytoskeleton organization	Interproscan
GO:0008360 all species →	Biological Process	regulation of cell shape	Interproscan
GO:0016477 all species →	Biological Process	cell migration	Interproscan
GO:0022604 all species →	Biological Process	regulation of cell morphogenesis	Interproscan
GO:0030866 all species →	Biological Process	cortical actin cytoskeleton organization	Interproscan
GO:0051015 all species →	Molecular Function	actin filament binding	Interproscan
GO:0016043 all species →	Biological Process	cellular component organization	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K23957	FMNL; formic-like protein	-	Cytoskeleton proteins	ko04812	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Chrysogorgia sp. JL179-B06 tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Chrysogorgia sp. JL179-B06, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →