Gene detail

Detailed information of Csp0G484180 in Chrysogorgia sp. JL179-B06

Genomic Location: Contig00856:6634437...6647324
NR annotation: no NCBI-NR hit recorded
Species Chrysogorgia sp. JL179-B06 · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Csp0G484180

ATGTTTTCAACGACGAATTTGACGACTTTTTTCCAGGAACGTTTGCAGGATATTAACAAGACTTTGAGTTCATCAAATATTTCTTTACGTTTCAAAGCAGTGACATTTCCACAAAGTGATAATCCTATCCGGTCTGCCTTAGATGTATGTGAGCACATTTTGAGTCGACAAGTCCATCTTGTGATTATCAACCATGGAAACTGCTCAAGTGATGCTGTTGTCGGTATCTCGTATACTTGTGGGTTTTATGATCTGCCAGTTATTGCAATACGTTCTAGAGATGCTATGTTCTCTGATAAGACCATTTACCCTTCATTTCTTCGAACTATATCACCGTTCTATGAACAAGCGAAAATCTGGATAGAAATCCTTAAATATTTTAACTGGAAGCAAGTACTGACAATTACATCAAATGAATATGAGACTAAAACTATGTATGCAAAATTCTTTGCATTGGCCAATTCAAACGGGATCAAGGTGGAGAAGTCCATTCTATTCACGCCAGACTCACTTAATTTGACTTCACAGTTGCAGACATTTTCAAAATCTGCATCAAGAGTGATTCTTTTGCTTGCCAATGGTGAGGACGCTGGGATTGTATATCGTGACGCATCGAGGTTATCTTTTACTGGAAAAGGATATGTTTGGATTGTTTCTGAACAAGCAGTGGTTGGAAGTCGACATAAACCTCCTTTAGGTTCAATTAGCTGTCAACTTACCCAAGCGTCAGATGAAGAGTCTCATCTTCGTGATGCAATTCAGGTTGTTTCCATGGCAATACAGTCTTTATACAGAGAAGGAAATTTGAAAAATATGTCGTTAGTCGACGGCTGTTATAGCACGTCTCCCTGGTCTGAAGGAAAAACTGTGTACAAAAAGTTATTGAATGTCACAATAAAAAATGGCTATACAGGACATGTAGCATTTGATAGCGCAGGGGACAGGCTGTTTGAAGATTACAAGATTGTAAACATTCAAAAATCAAACATTCAGGAAGTCGGCCACTTTCGAAACAACAGTCTATATTTAAATCGCGGAATTATTTGGCCAGGAGGATCTACAGAGATACCAGAAGGAATGTTTATCTCTAAACACTTACGGGTTGTGACTGTAAGGGAGTCTCCATTTGTGTATGTGAATAATCTTCCTAGAAATGGAAATTGTTCTCAGCTAAACGACGCAAGCAAAGAGTTTGTAGAATGTTCTGGCAATGTATTTGATCAACCCGGCATCATGGGAGATGGCGTTCGTTGTTGCTCTGGCTTTTGTATTGGTCTTTTGAATCTCCTTGCGAAGCAGGTCAACTTTACATACACTGTGCATTTAGCAGAGGACGGACAGTTTGGATCTTACGCAAAGGAACATGGGTCGACCAAGCGAAAATGGAATGGAATGGTTGGTGAAATTTTGGAAGACAAAGCAGACATTATTGTTGCTTCGTTAAGCATCAACAACGAGAGAGCCAATGTCATTGAGTTCTCAAAACCTTTCAAGTACCATGGTATCACAATTTTAGTCAAAAAGAATCAAAGTCCTAGTAGCTTGGATTCTTTTCTAAGACCATTTCAAATCCAGCTTTGGTTGCTTGTCTTGCTTTCCGTTCACGTTGTTGCTGTCATTCTCTATCTTCTTGATCGGTTTAGTCCCTTTGGAAGATTCCAGCTCGCTAAATCTGATAAAGACGAGACGCCGCTCAATCTGTCCAGCGCCATGTGGTTTTCTTGGGGTGTACTTTTAAATAGTGGTATTGGGGAAGGTACACCAAGAAGTTTTAGTGCCAGAGTGCTTGGTATGGTGTGGGCTGGCTTTGCAATGATTATCGTGGCAAGTTACACAGCCAACTTGGCTGCTTTTCTTGTTCTTGATCGACCAAAAGCTGTCGTTACCGGCATCGATGACCCCAACCTTCGAAATCCTTCCGACAGTTTCAAGTACGCTACTGTAATCAACAGCAGTGTGAATGATTACTTCAGAAGGCAGGTGGAGCTGTCTAGCATGTACACATTCATGGCAGAAAATAATGTCAAATCCGCATTCGATGGAGTTGAGGCTGTCAAAAATGGGAACTTGAAAGCTTTTATTTGGGATTCCCCCGTGTTGTATCACGAATCATCCAAGGATTGCTCGCTTACTACAGCGGGTGAGCTCAAGGGCTCGTTTTGGACAAATGACATCTCTTTGGCCATCTTAAACTTTCACGAAAGCGGCAAAATGGAGGAATTGGAGACACTATGGATTAATATTGGAAATTGTCCTGAAACAAGCAATGCACCAGCCACCCTTGGTTTGAGCCACATGCTTGGGGTGTTCATCATGGTGCTTGCTGGTATCGGAGCTGGCATCATTATAATTATATTAGAAATAGTGTATCACAAGCATCGTGGTTGGCGGGATGACCAGAGGGAACTGGCAAAGAGAACAACAGAAGTTTGGAAGAATAATGTGATGATGACAAAGAACAGCAGAGCTGGTCATTTTGCTGATAGTAATGGCGCAACTCGGAGACCTGAAAATGGAAATGTCATACAAGAAGCGCGAATTAATCCTATATATCTTTCCGATGCACAACTTTACTAG

Transcript

Csp0G484180

Protein

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000938 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00060 all species →	Lig_chan	Ligand-gated ion channel	Family	Interproscan
PF10613 all species →	Lig_chan-Glu_bd	Ligated ion channel L-glutamate- and glycine-binding site	Domain	Interproscan
PF01094 all species →	ANF_receptor	Receptor family ligand binding region	Family	Interproscan
PF10562 all species →	CaM_bdg_C0	Calmodulin-binding domain C0 of NMDA receptor NR1 subunit	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001508 all species →	Family	Ionotropic glutamate receptor, metazoa	Interproscan
IPR028082 all species →	Homologous_superfamily	Periplasmic binding protein-like I	Interproscan
IPR015683 all species →	Family	Ionotropic glutamate receptor	Interproscan
IPR001320 all species →	Domain	Ionotropic glutamate receptor, C-terminal	Interproscan
IPR019594 all species →	Domain	Ionotropic glutamate receptor, L-glutamate and glycine-binding domain	Interproscan
IPR001828 all species →	Domain	Receptor, ligand binding region	Interproscan
IPR018882 all species →	Domain	Calmodulin-binding domain C0, NMDA receptor, NR1 subunit	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR18966 all species →	IONOTROPIC GLUTAMATE RECEPTOR	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005216 all species →	Molecular Function	monoatomic ion channel activity	Interproscan
GO:0006811 all species →	Biological Process	monoatomic ion transport	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0038023 all species →	Molecular Function	signaling receptor activity	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0015276 all species →	Molecular Function	ligand-gated monoatomic ion channel activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K05208	GRIN1; glutamate receptor ionotropic, NMDA 1	-	Ion channels	ko04040	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Chrysogorgia sp. JL179-B06 tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Chrysogorgia sp. JL179-B06, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →