Gene detail

Detailed information of ENSLDHP00000019736.1 in Eunicella cavolini

Genomic Location: chr16:6967650...6976439
NR annotation: XP_028405826.1, LOW QUALITY PROTEIN: pseudouridine-metabolizing bifunctional protein C1861.05-like [Dendronephthya gigantea]
Species Eunicella cavolini · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ENSLDHT00000021610

ATGTGGCGATCCTGGCTGTGTCATCGGCATCAGTATGTTAGTGCCTTGGCAAAGTATTCAACTGGTTCATGGAAGGGCAAGACTGTCATCCACAGGGAAGTTTCTGAGGCCTTGCTGAAGAATAAACCAGTGGTAGCATTGGAATCGACCATTATTACACATGGCATGCCATTTCCACAAAATCTCAAAACTGCTAGATCAGTGATTGAAATAATCAGAAGAAATGGTGTCGTTCCAGCAACTGTCGCTGTATTAAATGGAGAATTGCACATTGGCTTAACAAGAAGTGAATTAGAATACGTCTCAAAGGTGGGAAAGTCGGCCATTAAGACATCGAGAAGGGATATACCTGCTGTTCTCAGTAAAGGTTTAGTTGGTGGTACAACAGTGTCTGGCACAATGGTTGCCTCGGCAATGGCCGGTATACCAATCTTTGTCACAGGGGGTATTGGAGGAGTGCATTATGGGGCAGAGAGAACGTTTGATGTGAGTGCTGATTTGACTGAATTGGGTCGAACTCCTGTGACTGTGGTTTGTGCTGGCGTCAAGTCAATACTCGATATTGGTCTAACACTTGAATACCTGGAAACTCATGGAGTTACGGTTGCGACTTTCGGTGATTCTCTCGAGTTTCCAGCTTTCTTTACACCAAACAGTGGTTTTAAGGTCCCTTACAACGTAAAAACGCCAGAAGAAGCCGCGTCATTGATAGAGTGCAATCTAGAAATGCGTATGAAAAGTGGTATGGTGATTGGTGTACCTATCCCAGAATCTCATGCGCCACTTGGAACTCAAATCGAGGCAGCTATTCAGCAAGCCTTGCAAGACGCCAAAAATAAGGGGATTTCTGGAAAAGAAGTGACTCCATTTGTTCTTCAGAGAGTCAATCAACTTACCAAAGGAAAATCTCTTGAAGCTAACATAGCACTGATTCAAAACAATGCGCTGGTTGGAAGTCGCATAGCTTTGGAATTTAGCAAGTTGAGGGAGATCAAGGCATATGGCAAACCACAAACGATACCAAATATTTCCGAAGACCAGGCTCCGAAGACTGCAAAACAGCCGGTTGTTATTGGTGGTTCGAATGTTGACTTCACAGCCAAAGCGAACTCCGAAATCATGTTTCACGGTGTTACAAACGTCGGAAGGATACGTCAGACGTTTGGCGGGGTTGCCAGAAATATAGCAGAGTGTATCGCTCGTATTGGTCACTGTAAGCCGCTGTTGATATCGGCAGTTGGTGGTGATGATTTAGGGGAGATGCTGCTAAGACAGTTGGAGTTAGTCCGCGTCTCAACCTATGGTGTTCACATTAGCAAGGCCAGTAACACAGCTACCTACTCTGTTGTTCTGAACAACCAAGGCGAGGTGGTTGTTGGGATAGGTGATATGGAGGCACATGGTGAAGTCACAGCTCAACTGGTGTCTGCATTTGAAGAAACAATAATTAATGCACCAATAGTCATTATTGATGGCAACATTGAGGAGGAAGTTATTCATTATTGTATTGATTTGTGCAAAAAGCATTCTATACCTGTGGTATTTGAACCGACATGCGTGATGAAAGCAGCGAAACCATTTAAAACAGAAAGTTGGAAAAACATAACGTTCACAACACCGAACATAAACGAGCTACGAACTATGAATAAACTTGTCAACAAACACGATGAAATCACGAACGAATCCGAAAGTGAACCGAATGACCTCGAAGACTCGGCGACTGAAATGTCGAAACCCTTGGACGATATATTAAGGGAATGTGTAGGGCTATGTAGGCCGCTAATGGAACACATTTCTACAATAATAGTGACTTTGGGCAAACACGGAGTGTTAGTCTGTCGAGATGTGCCATTCGACACACCGTTTACGGAAGAAGGGAAATTTGTTGGGGTTGGAAAAAGAAAATTGAATGGTCTTGTTTCGGCTGTGCATTTTCCCGCGTACGGAAATGAGCAGGACCAAGTGGAAGTTGTGTCGGTGACCGGCGCTGGGGACAGTCTTACAGCTGCTTTCATTTCGAGTGCTTTGGCAGGCCACACCCCAGAAGTTTGCATGAAGGCAGGCCTCATGGCGGCCTGGTACTCAGTCCAAGGCTCCATGGCCGTGTCCACGTCAGTCATCCCAGAACAGTTTACTATCGATAGAATACAATTTTGGGCGCCATGGCAACCGAATGTTTTGGATATTGAGGGATATGTATAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A7GCK7	Pseudouridine-5'-phosphate glycosidase OS=Clostridium botulinum (strain Langeland / NCTC 10281 / Type F) OX=441772 GN=psuG PE=3 SV=1
Q8RCT3	Pseudouridine-5'-phosphate glycosidase OS=Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4) OX=273068 GN=psuG PE=3 SV=1
Q84K35	Pseudouridine-5'-phosphate glycosidase OS=Arabidopsis thaliana OX=3702 GN=PUMY PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004162 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF04227 all species →	Indigoidine_A	Indigoidine synthase A like protein	Family	Interproscan
PF00294 all species →	PfkB	pfkB family carbohydrate kinase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR007342 all species →	Family	Pseudouridine-5'-phosphate glycosidase	Interproscan
IPR022830 all species →	Homologous_superfamily	Indigoidine synthase A-like	Interproscan
IPR002173 all species →	Conserved_site	Carbohydrate/purine kinase, PfkB, conserved site	Interproscan
IPR011611 all species →	Domain	Carbohydrate kinase PfkB	Interproscan
IPR029056 all species →	Homologous_superfamily	Ribokinase-like	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR42909 all species →	ZGC:136858	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004730 all species →	Molecular Function	pseudouridylate synthase activity	Interproscan
GO:0016301 all species →	Molecular Function	kinase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K16330	K16330; pseudouridylate synthase / pseudouridine kinase	EC:4.2.1.70 EC:2.7.1.83	Pyrimidine metabolism	ko00240	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Eunicella cavolini tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Eunicella cavolini, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →