Gene detail

Detailed information of ENSXLYP00000010578.1 in Pelagia noctiluca

Genomic Location: chr17:2123212...2198058
NR annotation: CAH3118123.1, unnamed protein product, partial [Pocillopora meandrina]
Species Pelagia noctiluca · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

ENSXLYT00000011046

ATGTTCACTAGTTTCTTGTTGATCGCATTTCTTGTATCAAAAGCACGAGGGGATGATTTATGCAGTAATGGCTTGACAACTAAAAATTGGGGTTGCTGTGCAAGAGAGTTCGAGGAATTCTGCTGCTCTTTCGTCAGCAAATGCGACGAGTCTACAACCAACAACACAAATGTCGCAACCAATTCTTCAACTTCCACAGCAAGACCTGAATGCTCGCTGCCTTATAGTACAGCAGCGTGTCTAGCAGGGTTTTACAAAGGTTCGAGTGGCAGCGTCTTACCATGTCCGGACGGATTTTACTGTCCTGCGGGCACAACTTGTCTTCTGCCTTGCTCAGCCGGTTCAATCTGTCTGAAAACAGAGTTGTTAACACCTACGAATGCAAACATTACGCTGACAGTGCCCCAATGTAACGATTTGGTCTCAAGTCCGGTCTTTATCGATGAGTTGTGGACCTGTCCTGGATGCGGCACACCAAAAACTTGTGATGCCGGATATTATTGTCCGAATACGTCCGCGAAATACGCCTGCCCTGAAGGACATTTTTGCAGACTTGCGTCAATAAGGCCGAAGAAGTGTCCGCTCTCGGAATATTGTAGCCAGGGTTCCTCAGCAAGTGCTTTCATCACAGCTGTTCCGGTCCGAGCTGGGATAATTCTGCTACTAATGGTTGCTATTTATTACGGTTACAAATACAGGGCCTTCTTCTTGAGGTACTGCAAGTGGTGTGCAAGGGAGACCGAGCGGAAATCACTTCATTCCGCGCTCGGACAGATTGTTCTGACAGTCTGCCAGACAAAGCCTATCTTGATACAAGCAGCTAAAAACAAAACCAAGGTAAACATAAAATTCAGAGATGTCAGATTCAAGTTGAATACAGGCACTCGAACGGGAGACTTGCTGAACGGGGTGAACGGAACACTGGATAGCAACAAGATAACTGCGATAATGGGGCCCAGCGGTGGGGGAAAAACTACCCTGTTGAATATTTTAAGTGCAAGGGCTTCATACGGGAAGTTGAGCGGAGAGTTCGAGATAAACAAAAAGTCTTTCAAAGATATGAGTGCTTTGAAGAGCTTGATCGGGGTGGTCCCCCAGGATGACATAATGCACGAGCAACTGACCCCCAGGGAAGTGCTGACGTACCAAGCTCGACTTCGCCTGTCCTCTTCCGTGTCCATGGAAAAAATCAAGGAGAAAGTGGACATTGTTCTCGACTTACTAGAATTGAAGCCGGTTGGGGACACTGTGATTGGGAGCGTTGAAGAGAGGGTTCTGTCTGGGGGTCAGAGAAAGCGGGTTAATATTGGAATGGAACTAGTGGTGGATCCTTGCGTGCTACTGTTGGATGAGCCAACAAGTGGCCTAGACAGCTCTTCGAGTTTGGCTGTGTTGAAGGCGTTGCATTTCTTGGCAGAGAAAACAAACCTGACCATCGCTACAGTTATTCATCAGCCTCGTTATGAGATATTCTCCATGCTGCACAATATCATTCTTCTTAGCTCAAGTGGCAAAACCATTTATCAAGGAAGTCCGGATGAAATGTTGTCTTATTTCAAAAAGCAAGGATTCGTGCCTCCAACAGAAGTAAACCCTGCTGATTTCATCCTTGATGTTATCACTGGGGTATCATGGCACCCTGAAGAGTCTCCCAGCGCCCCCAGAGCCCCCAGCTTTTTTTCGAAAAGTACCATTTTAGCTCCATGGAATCTGATGCCACGTAAAGACGCCGAGTCTGAGAAGCCTGAAGAAACTTGCTCTGCAGACGCCACCAACTTCAACCGCAAGAAAAACTTTTTCTACCAGTTTTGGGCTTTTCTTATTCGCGAGTTCCTTTTACAGAGAAGGAATCTTTTCACCGTTCTGATGAACTATGTCCTGACGGTTATTGGAGGCTCTATTGTTGGGGCCATTTACCAAGAGGTGCCCCTTACCAAACTCCTCCTGATGGCCACAATGAGTTCGCTGATGATGGGTCTGACCGGCTCACTAATCTCTCTAAGATGCTTCAATTCATACCCGTCCGTGTTCATGCGAGAGGCATCATCCGGCATCAACCTGCTGAGCTACTACCTCGCAGTCAACATCGCCCAGTTACCCCATCTGGTGCTGCTTCCCCTCTTCTACTTGAGCTTGAATTACCTGCTCATCTTCCCTAGAGCATCCTTCCAGCATTGGTATCTGATTGCCTTTGCTACATACCTAAACGTGTCCGGATTGGCCTACATCATATCGATTTCATGCAGTCCGAAGAACGGACAAATGGCTTGTGTAGTGATTATATTGATATCCTCCATGCTGGCCGGTACGACGCCTACCCTTTGTGATCTGAATGCGATTCCGTACGTTGGACCTGCCATGTACAGCTTGTCCTTCTCGAAATGGTTCGCAGAAGCGTCGTTTGAAAAAGAGGTCGAAGGCCTACCTCTCGCAATGGAGTGGACTGTCAACTATTATCGCAACATGAACGACTACTCGCTGGATAATTTCAATAATGCCATTCTTTTTCTGGTACTCTCAGGCTTTGGTTACAGAATCCTAGCTTTACTTGCACTGTTCATAGTCTCTCTTGCACGTAAAAACGTCAAAGGGTAG

Transcript

ENSXLYT00000011046

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9MAG3	ABC transporter G family member 24 OS=Arabidopsis thaliana OX=3702 GN=ABCG24 PE=2 SV=2
Q9FF46	ABC transporter G family member 28 OS=Arabidopsis thaliana OX=3702 GN=ABCG28 PE=3 SV=1
Q9SJK6	Putative white-brown complex homolog protein 30 OS=Arabidopsis thaliana OX=3702 GN=WBC30 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003011 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00005 all species →	ABC_tran	ABC transporter	Domain	Interproscan
PF19055 all species →	ABC2_membrane_7	ABC-2 type transporter	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR003439 all species →	Domain	ABC transporter-like, ATP-binding domain	Interproscan
IPR003593 all species →	Domain	AAA+ ATPase domain	Interproscan
IPR050352 all species →	Family	ATP-binding cassette subfamily G transporters	Interproscan
IPR018527 all species →	Binding_site	Rubredoxin, iron-binding site	Interproscan
IPR043926 all species →	Domain	ABC transporter family G domain	Interproscan
IPR017871 all species →	Conserved_site	ABC transporter-like, conserved site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR48041 all species →	ABC TRANSPORTER G FAMILY MEMBER 28	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0042626 all species →	Molecular Function	ATPase-coupled transmembrane transporter activity	Interproscan
GO:0055085 all species →	Biological Process	transmembrane transport	Interproscan
GO:0046872 all species →	Molecular Function	metal ion binding	Interproscan
GO:0140359 all species →	Molecular Function	ABC-type transporter activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for ENSXLYP00000010578.1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Pelagia noctiluca tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Pelagia noctiluca, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →