Gene detail

Detailed information of FUN_008516-T1 in Acropora pulchra

Genomic Location: ptg000002l:12415681...12420201
NR annotation: XP_029205647.1, ATP synthase subunit gamma, mitochondrial-like [Acropora millepora]
Species Acropora pulchra · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

FUN_008516-T1

CAATATGGCGGCGAATGAAGTATTTCTCCGTTGTGCCGTTTTTCGGCCAACATCATGCCCGGGAGTGAGAAATATGGCAACGTTGAAAGATATTTCAATGCGTTTGAGAAGTGTAAAGAACATTCAGAAGATTACCAAATCAATGAAGATGGTGTCAGCAGCCAAGTTTGGTAGAGCAGAAAGAGAATTGCGACCTGCAAGAGTTTATGGTGCAGGTGCCTCAGCTTTGTACGATAAAGTAGAGATTCAACCAAGTGAGGCAGAAAAAACCAAGCCAAACAAGCTGATAGTGGTGATGTCTTCAGATCGTGGATTGTGTGGTGGAATCCACTCCAACTTGGTCAAAGCTGTAAAAGCTGCAATGACAGAAAAAGAAGATGAAAATGCCAAAATTGTGGCATGTGGGGAAAAATCCCGTCAACTTTTCCAGAGGACACATGCTGACAAGTTGATGATGAGCTTCTCAGAAATTGGAAAAAAACCCCCACAGTTTTGTGAAGCTACTTTCATAGCCCAGGAGATCTTAGACAGTGGGTTCCAGTTTGATTTGGGAGAGATGTACTACAACTGGTTCAAGTCAGTAGTCTCATATAAGACACTTACGAAACCACTTGTTTCATTTGATACCTTGAATGCTGCTTCAGGAGAGGTGCTCAGTTCATATGATGACCTAGACTCTGATGTGGTAAAGAACTATTCTGAATTTTCCTTGGCCAGTCTCCTTTTTTATGGTATGAAAGAAGGAGCTTGTAGTGAGCAAAGTTCACGCATGACAGCCATGGACAGTGCCAGCAAAAATGCCGGTGAAATGATTGACAAGCTGACTCTTACTTACAACCGCACACGCCAAGCTGTCATCACAAAAGAGTTGATTGAGATTATTTCAGGAGCTGCTGCTCTTGACTGAGCTTCTTTTTTTTCCTCATTTTATTGCCTTTGACTGTGCTTTCCAATATTGTGTTTGTAAAACTTGAATTAAAAATTGACCTCATAAAAGTTAACTTTTACCTGTTAATGGGAGTCCCTGTTAAGCCCTAGTAACACCTCACACTATAACCCCTTTAGGTTTTGCTTCGTTTTGGTGCCCTCTTGACTATGAGTGCTTACCATTTCCATGGAAAAACTGTTTATGCGTCAGTCAGTTCCTCCTGGGCCTGGCCCATAACCCAGCTAATCCTTTAGCTAATTTAGCGTGGCATTGGGGCTGGGCATTAGTCAACACCAGGGGCACCTTCCGGCTCTTGACACCCACGTGGTTAGCTTTAAAACGTAGAGAATTTTCGATGTTATGATCACAATTTTTGGGGGTCTTTTAGTGGTTGAATGTTTTTTATTGTCACTTTGCAATGGATGCCAATATCATTTAAGACTTATTGCGAACTTCAAATTTCAGAAAATGTGAATTGGGCCTTAAAACATGCTTCATTTCTTGGATAGAGCTAGTACTATGATAATTTTTTTTTGGTAATCATTCAACAGATTTCTGTTATTTTATTAATATTGGTTATAGGACTGAGGGGAGTCCAATTTGGTGTGTAGTCAAACGAGTGATTAACATCACAAGTTTGATCACAGACCAAATAGTTGTGTTACCAATTAATCATAACCATTACAATTTTAGAGAAAACAAATGCATTCCCCTTTTTCTGTAAAAAAACTTTTAATATCAAGCACCGAAAGAAATGCATCACAATTCATCCATTTTGAAAAATCCCCAGTTTGGTAGGGTAAGTGGTTGTTGCTATGGTTATTGTGATAAATGATGTGGGTGGATTAAGCTTAATATGATTAGCTGATTCAGGTATCCAATTACAATGAACTGTCCGATTTCAACTCTAAAGAATAATTGTGAAAAATAAAGCAGTTAATGCACCAATCAAATTTGAGAAAATTGTAAATTATGGTATTGATTAAATCTCGAACTATGATATAGCAAGATCAGGAGCTTTGAGCGTGCATGAATCGTTGAGTTTCCCAACCGGCTACATTTGATTCCTGCTATGTCATATTAAAATGCCAGTTTTTGGTTAAAGCTATGGAAATTTCAAATCAAGAACTATAACATGAATAATAAAAAATGTCTGTATTAGATAACATT

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P05631	ATP synthase F(1) complex subunit gamma, mitochondrial OS=Bos taurus OX=9913 GN=ATP5F1C PE=1 SV=3
Q91VR2	ATP synthase F(1) complex subunit gamma, mitochondrial OS=Mus musculus OX=10090 GN=Atp5f1c PE=1 SV=1
Q4R5B0	ATP synthase F(1) complex subunit gamma, mitochondrial OS=Macaca fascicularis OX=9541 GN=ATP5F1C PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0007373 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00231 all species →	ATP-synt	ATP synthase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000131 all species →	Family	ATP synthase, F1 complex, gamma subunit	Interproscan
IPR023632 all species →	Conserved_site	ATP synthase, F1 complex, gamma subunit conserved site	Interproscan
IPR035968 all species →	Homologous_superfamily	ATP synthase, F1 complex, gamma subunit superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11693 all species →	ATP SYNTHASE GAMMA CHAIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0015986 all species →	Biological Process	proton motive force-driven ATP synthesis	Interproscan
GO:0045261 all species →	Cellular Component	proton-transporting ATP synthase complex, catalytic core F(1)	Interproscan
GO:0046933 all species →	Molecular Function	proton-transporting ATP synthase activity, rotational mechanism	Interproscan
GO:0000275 all species →	Cellular Component	obsolete mitochondrial proton-transporting ATP synthase complex, catalytic sector F(1)	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K02136	ATPeF1G, ATP5C1, ATP3; F-type H+-transporting ATPase subunit gamma	-	Diabetic cardiomyopathy	ko05415	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora pulchra tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora pulchra, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →