Gene detail

Detailed information of FUN_010640-T1 in Acropora pulchra

Genomic Location: ptg000007l:1096838...1103076
NR annotation: XP_015756407.1, PREDICTED: eukaryotic translation initiation factor 2 subunit 1-like [Acropora digitifera]
Species Acropora pulchra · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

FUN_010640-T1

GCGAGATGGCTTTCCTCCTAGCCAGCGGTTACGCCATTGCGTCAGTCTTCGCACATGTAAGTGAGTGAGGCCTTTTGATCTTGAAGCTCATTTTCCTTTTCCACGATGCCTTTAACCTGCAGATTTTACAAACACAAGTATCCAGAAATCGACGATGTTGTTATGGTCAACGTACGAAGCATTGCAGAGATGGGAGCGTACGTCAATCTGTTGGAATACAACAACATCGAAGGGATGATTTTGCTCAGTGAACTATCGAGAAGGCGAATTCGTTCAATTAATAAACTGATCAGAGTTGGAAGAAACGAGTGTGTGGTCGTGATTCGTGTGGATAAAGACAAAGGTTACATTGACTTGTCTAAAAGGAGGGTTTCACCTGAAGAAATTAAGAAATGTGAGGAGAAGTTTACAAAAGCAAAGGCAGTTTACAGTATCTTAAGACACTGTGCAGAAATCTTGGAGTATGAGACAGATAAACAGCTGGAGGAACTGTATGAAAAGACAGCTTGGCATTTTGATGAAAAGTTTAAGTCACCAGGAAGTTCATTTGATGTTTTCAAGCTGGCAGTGGGGGACCCTTCTGTGCTAGATGAGTTAGATCTTGATGAGGACACCAAATCTACTTTACTGAACAACATTGCCAGGAGATTGACTCCCCAAGCTGTCAAAGTCCGAGCTGACGTTGAAGTATCATGCTATGCATATGATGGCATCGATGCTGTAAAGAACTCCTTGCTAGAAGGATTAAAATGCTCTTCAGAAGAAATACCAATCAAGATAAATTTAATAGCCGCTCCCTTGTATGTGATCACCACAACAACCTTGGATCGTGATGAGGGACTCAAAAGCTTGACATCAGCTGTAGATGCCATCAGATCTTCCATCAAGCAATATGGCGGAGACTTCAACGAAAAGGCTGCGCCTAAAGTGGTGACAGATAGTGATGAAGCTGAACTGGCCAAGCAAATGGAAAGATTAGAACGAGAAAATTGTGAGGTGGATGGTGATGACGATAATCCAGATGAAGAGGAAATATCAGAAGAAATATAATAGAATACCAGATGATTTATTTTACAGATTTCTTCCTCATAATAAGGGTTTGACTTCTTCCTGGAAAATTTACTGTTTACCAGAATGTAGCCAGTAGAACACGTACATATTCAAGTTGTCAAAACAGTATTTCTTGAAGAATGGAAGATGGTGAAGGAGGAAGAGGTTGTAAAATTGTAGGATTTGGACCATGTGAGTAAAATAAACCAATGAGAGTGTTGGAAAGAAAATAATGCTGATAATGGCAAATTTACAAGTCACATGGTGTAAATATTGAAGTTTTATTGGTAAAAACCTTTTCCCATAATTATGATCTTACCTGAATGCTCATTTTCCTTTCCTAATTCTGAGAAACTCTTCTGTTACCTTCTTTGAAAAAATCAATTAAGGGACACATTGCTGCAAATGATGGCACTGATTGCTATATATTCTTACACAGAATATGTAGTGAAAATTTTAAGGTTTCATCTTGTCAATAACAATTCACTCCATACTTAAAGCATCTAAATGGCGTTGATATCAATCAGTAACTCTTCAAGAAGTGCAGGGCATGCCACAGTCCACGAAAATCAGTCCTTCATAATTTAACATTTGAGGTCACTATGAAACATGCATCCTCTGCGCATCTCAAATCCTCAGTTCAAAGATTGCAAAGATTTGAATGAATGATGTCATACCAGTTAATTTTATCTCAGATCTAATGTGGTTATGTTATTGTTTCATTTGTAACTGAATTAAGTTTTTTCTTCATTAAGAACTTGTGAGTCAGAATCTGAAATTTCATCTTCTCCAAGAGTTCCTTCATTAAATGGCTCCTCAGTGATTAAGTGTTGTGATGATATCAGACCATTGCTATCACCTTTCTCTTCCTGGTAAAACTCATGATTCAATGTATCTTCTGATATGCTGTGTTTATCTGGTTGTGTTAGTGATACTTTGGTTCTTTCATCAATGCTTTTCTCTACTAACTCTTTGTCTTTCTGCTTTCCACGGCGGAGACCCAAAATCTGTAAAAGTTAAAGTAAATTAAGAATTTGTATTTTAGCCTGACTTTTTGGTCAGATGTGTTTGAATTTTCTTGTAAGACAGTACTTCATCCACCTCCAAAAAAAAAATTCTCTATCCCAATAACTGACCCTCTTATATTACCCACTGAACTCAAATGAATTTCTAGAAAGCACTTTACTGTAGGTGCAAAGGCCAGAGTTTGTTGTAGAGTCTTTCTCATGTCACTTCAATTTAAGTAAAATTACAAAGTTATTATTGAAAAATAATTACCAAACAACATTTTGCATCTCCACAAAC

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6GL89	Eukaryotic translation initiation factor 2 subunit 1 OS=Xenopus tropicalis OX=8364 GN=eif2s1 PE=2 SV=1
P05198	Eukaryotic translation initiation factor 2 subunit 1 OS=Homo sapiens OX=9606 GN=EIF2S1 PE=1 SV=3
P68102	Eukaryotic translation initiation factor 2 subunit 1 OS=Bos taurus OX=9913 GN=EIF2S1 PE=2 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006855 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF07541 all species →	EIF_2_alpha	Eukaryotic translation initiation factor 2 alpha subunit	Family	Interproscan
PF00575 all species →	S1	S1 RNA binding domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR011488 all species →	Family	Translation initiation factor 2, alpha subunit	Interproscan
IPR012340 all species →	Homologous_superfamily	Nucleic acid-binding, OB-fold	Interproscan
IPR024054 all species →	Homologous_superfamily	Translation initiation factor 2, alpha subunit, middle domain superfamily	Interproscan
IPR003029 all species →	Domain	S1 domain	Interproscan
IPR024055 all species →	Homologous_superfamily	Translation initiation factor 2, alpha subunit, C-terminal	Interproscan
IPR044126 all species →	Domain	IF2a, S1-like domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10602 all species →	EUKARYOTIC TRANSLATION INITIATION FACTOR 2 SUBUNIT 1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0003743 all species →	Molecular Function	translation initiation factor activity	Interproscan
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan
GO:0005850 all species →	Cellular Component	eukaryotic translation initiation factor 2 complex	Interproscan
GO:0006413 all species →	Biological Process	translational initiation	Interproscan
GO:0033290 all species →	Cellular Component	eukaryotic 48S preinitiation complex	Interproscan
GO:0043022 all species →	Molecular Function	ribosome binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K03237	EIF2S1; translation initiation factor 2 subunit 1	-	Translation factors	ko03012	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora pulchra tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora pulchra, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →